Description :
From Genome Similarity Track
Location :
Scaffold_14:59926- 61243
Sequence
1317 bases(100 bases per row)
CTATGCTAGCCCCCAAAATCCTAAAAGCACAGCAATGGGTATCGAAGGCCTTTCACGCAAAGGCTCTGGCACGCTCCGAGTTCCGATCTACCTACGTCAT
ATTGCTACCTGTGTCCGTGCGGCTCAGCCGTTCCTACAGCGGCTCCGGGCCCAAGAGGGTCGCCTCCACCGGTGCCACCTCATCAAAATCACGGTCGATA
TGAAACAGGATCTGGTGTGGTGGTATAGAATTCTAAAGCTGCCCGTGATGAACGGAGTCCCTTTGTCTTATTTCAGGGCCTCTCCACCCCCTCACATCGT
TGTGGAGATGGATGCATCTGATGCGGGAATTTGTACCCTCGATCGGGCCGCAAGTGCGCCTTAACTTTCTCATTCTCAGATGCAGAGCTGACTCTCATTC
GAGAATTCCGGTCGGGAGTAAACAACAATTTTGACATCAATTATCGCGAACTCTTGTCGTGCGCTATGGCGGTCTACACGTGGGCGGCGTCATGGCGAAA
CTTCGCGACGGCATCGAACCCTACCGTGCATGTTCACTTTCGTATTGATAACACCTCGGCGGTATCATGGCAGAACAAAATGAGTTCTACGAATCCCCGC
GCCCAACTTGTGATACACTTACTCGGATACTGGGAAACCATTACGGCTGTCGATTTTCTTTATCTCACATCGCGGGCGTGGACAACGTGATCGCTGATGC
TGGCTCCCGTCTCCCGGATCGACATTACGCTAACCGATTTGCTAACCTTACACGTGACTGGATGCAGGTGACACCAGATATCAGCAGCCTCGGCCTAACG
AAGATTTGGCTCGATATTTGCGCGAGCATTCGGTGGCAGATATTACCCTCAACAAATACTCGAAGGCCTATTTGAAATGGCGGCAGTGGACCACCTAACG
CGGCATCAACCCTTGGATGGACAACGTCGAACCTGCTCGTCAGCTACAGCACATCTCGGGGTTTGTTTTACATGGCTTTCAGCATGGCGTTGGGTCGGGT
CGTTAAATTTCGAGCTCAACGATAAGTGGGTATCTTATGGGTGTGCGGCATTTCTTCCTCGCAACGGGGCGTACCTTCCACTACGACCATCCACAGATTC
GCATGCTTCTCAAGGGCATAAGCCGGCGTGATACACTTCCCCAGCGCAAGGCCCCAGTGTCCATCCGTCTTCTAGAAGCCTGCTTTACACGCCTGAGCCT
CCGGAACCCTGCGGATCAGACTCTATGGGGGGCACTGTGTATGTCGTTCTTCTTCCTCTTCCGCCGGTCAGAGATCGTGTCTGTGAGCGCTGGTCGATTC
CGCTGGTTTGCAATCCG