Description :
From Genome Similarity Track
Location :
Scaffold_58:59925- 61426
Sequence
1501 bases(100 bases per row)
TGTCCAAAGACAAGGTATATTGTTACACACGGAGCTGGTATTTACCAATCGAAATTACGGTACCAATACAGTCAGCACAATGTCAGTATGCATCCGTTAA
ACACAGGCCTAAACTCTGTTTAACGGATGCGTACTGACGTTTTAGCAGCTGAAAACGACTTAGCAAGTCACCAACCCGTCGTAAATAGCTACACATGAAG
CTACTACTATTTAAACGGAGAATATCGGTACAAATACAATTTGCACAGGTCTAACCTTTATTTGTCTTAGCAAGTGACTAAAACATCGCATATTGGTACC
CACGGAATCCCTACTTTTTAAATCAAAATGCGGACATAAACAATACAGTTCGCAAAGTTTGAGCGTGGTTTTAATATTCGCACCGTCGTTTGGTATACCG
TCCTTATAGGAACCGGTCCCGACTTAGCAAGTACAAATTCAGACAGCACAGGCCTAAACGGTGTTTAACGGATGCATACTGACGTTGTAGCAGCTGGACA
CGACTTAGCAAGTCACCAACGCGTCGTAAATAGCTACACATGAAGCTACTACTATTTAAACGGAGAATATCGGTACAAATACAATTTGCACAGGTCTAAC
CTTTATTTGTCTTAGCAAGTTACTAAAACATCGCATATTGGTACACACGGAATACCTACTTTTCAAATCAAAATGCGGACATAAACAATACAGTTTGCAA
AGTTTGAGCGTGGTTTTAATATTCGCACGTCGTTTGGTATACCGTCCTTATAGGACACCGGTCCCGACTTCGCAAGTCCCAAAGACGTAGTACACGGAGT
GGTATTGTCAATTGAAAATTGCGGTACCAGTACAACTTGGAGAGGTGTAAACGTTGTTTAGTGTAATGCACACTGTATTTGTAGGAGTCTGACCCGACGT
AGAAATTCCGAAAAGACATAATACATTGCTGCCCCATGATGCTACTAATTTCTAGATAAAAAAATGTCGATTCAAATACAGCTTGCACAGATCTAAACGG
TTTTAAACGGAGTTTCCACCGACCTTGGCGCCAAAGGAGTCCGCCTTAGTATGTCCAAAGACAAGGTATATTGTTACACACACCAATACAGTCAGCACAA
TGTCAGTATGCATCCGTTAAACACAGGCCTAAACTCTGTTTAACGGATGCGTACTGACGTTTTAGCAGCTGAAAACGACTTAGCAAGTCACCAACCCGTC
GTAAATAGCTACACATGAAGCTACTACTATTTAAACGGAGAATATCGGTACAAATACAATTTGCACAGGTCTAACCTTTATTTGTCTTAGCAAGTGACTA
AAACATCGCATATTGGTACCCACGGAATCCCTACTTTTTAAATCAAAATGCGGACATAAACAATACAGTTCGCAAAGTTTGAGCGTGGTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
N