Description :
From Genome Similarity Track
Location :
Scaffold_198:5992- 8292
Transcript NameFunction/comments
Sapdi_VS20SDRG_17105hypothetical protein
Sapdi_VS20SDRG_17106hypothetical protein

Sequence
2300 bases(100 bases per row)
CTCGAGTGCCGCCTTGAGCACGTCGACTTGCTTCTCGGTTGCTCTGTCTACGCGCTTGAGATGCTCGTCGGCGAGGACTGGCTCGGTGAGGACGCTCTTC
TTGGGCGAGACGCCCGAGCTTGTCGCGAGGTGCGTGTTGTGAAAGGCGAGCTTGGGGCCGGTCACAAACGCTGCGTCTTCGGGCCACATCGCGGGCGACC
CCGTCAACTTGGGTGCGAATGCATTCTCCGTGTGGAACTTGCCGAGCACTTTGAGCGGCGACGGCGCATTGTACTTGGTCGTCGTCAGTGGCGGCACCGT
CCCCGCGGTTGTTTCCTGTGCGAGCAGTTGGATCGTACCCCGGGCGCCATACCTACGCCCTTAGGTTTCATTGCAATGTCATATCTGCACTCGCTACCGC
TTGGTTTTGGCCGCGAGGTCGCACGTCGGCACATCGGGCACGTTGTTCCGGCCAACGTACCACGGCGTCACGTTCGCTTGCGCGGTTTCTTTGATGGGCG
AGACGACGACGACCGGCGGTGTCGCCAGAAGACTCGGTGCGCTCGCGCTGGAGCTGTAGCAGTTGTAGCCCTCGCGACTGAGTCGGAGGCGTGACCGCAG
CTCGTGTCGATCTTTTGCAATCGGCGACGGCAAGTACGTCATGCGCTGCTTGAGAAACTTGTCTTCGAACGACACGTTGTACAAATCCGAGATGCGCTTC
GAGTCGCGCGACCGCTGGAGCATCGTCGCGTCGTCTTCGGGGAGACAGATCGTTTCCCGGCACGACCCGTCGAGGATGTGGTCGATGCGCTCGTTCACTG
TGATCTTGCGACTCCGCACGGGCGGCATCATCGGAACGAGCGCCGGTCGGTCGGTCGACAGCGCAGAGATGGTGAGGCGGTTTCACCAAAAAGGCGCCGG
GCCGTTTCAATACAAGAGACGAGCATGGTGAAGTTGCTACCGTTGGAACCTGCGAGCGCCCCCATTCGTGATGGCAAGTGACCAAAGCTCACGAAACCAA
GCGTGATCGACCCAAGCGCCGGTGCATTGGCCAAGCTGAGGGTGCTATAACGGCGTGTGTGAACTGTTGTATCGTTCTTCTTCCGCCGCCTACCTCTTCC
CAAGAAAGGATCACAGAAAGAGAAGAGTCTCTCCCAACGGGCGGACCGGTTGGTCTGCCTTCCTCAACGGGATTGACCACAAACCAATTGGACGGTCAAG
CATCAAGCGACATGGGCACTTCCACGAACCAAAGCCAGGCGAACGACAAGGCGTCGCGTCTCGCGTCGGCACTCTTGACGACGGCAGAAGCACTCCACGA
GGTGCAAGGCGCCTTGCGCATCGAGCCGGACGACAAGGTTTTGGTGGTTGCGCAGCGTTTCAATACCGCTTTGGAGGAGCTTTGCTTGACGCAGTGGACG
ATCGACAAGCGCAAGCTTCGCGACAAGAACACTCTATTGACGCGACTGCCCGTGCTGGATGACGTCCTCGCTCAAGCGCATCGCGAGGTGTCGGCGACGG
TGGCGAACTTGACGGACGACGAGGTTGTGGCGCGTGCCAGCGGCGGCGTCATGCTTTCTGGCCACCCGCTTGGCTATTCCAGCCACAGCACGTCGATGCA
AAAGGTGTTGTTGTCGCCGCCGACGCCCTGCGTTCTGACGACCACACCGTCGACACCGGTACTTTTGAGTCACTGGTTTGAGTCTGCGACGACCGCCAAT
GCGTTTCGCCAGCGCATTCAGGCGCACGGGTGGTCGTCCGCCGAGACGCCGGCGCCGTTGCCCACGGCGGGCGACGTGACGCGCCTGGTGTATGTGGCCA
GCGCCTACGTCCCAACCGCCACGTTGACGATGGAAATAGATGCGATGCGCCTCTCTTCGGACGCGGAGTGCGATGCACAGTCGATCATCGACGCTGCATC
GGCACAGGCCTTTCTCATGGCCTACGGGTCGCACGTTCACGGCGGTCGTTTTGAGCTTGGTGGAATCTTTTGGAAAACGACTTCTCTCTCAGTCGATGCT
GCGATGCCAGTCGACGTGCTGCGACAGGTGCTATCGGAAGCCGAGTTGCGCGACCTCTCGCTCGCGTACAGCGACTTCACTTACGGCGCTGGCGTCGACG
TTTACACGGCACTGGCGTCGGAACACAAGATGTGCGACATCACAACGCAGCTGGAGTACACAGGACCGATGGCGCCCAGTGCCGACACGTTTGCTGAGCG
CCTGGCCGCGGACAAGACCACGTGGCGCGTGGTGGATCGACCAGCGTCCCTGATTGGTGTCTGGGTCCTCCTCCGAGCGACAGGGCACGCGCTTGCCGCA