Description :
From Genome Similarity Track
Location :
Scaffold_351:5991- 8443
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_351-snap-gene-0.12Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_351-fgenesh-gene-0.1PH domain containing protein
Pytve_DAOMBR484maker-pve_contig_351-snap-gene-0.22Transmembrane protein

Sequence
2452 bases(100 bases per row)
CCTAGGAGTCGGCGCGAGAGCTCGATGGACCTCGAAGACCTTACTGTTTAACATTACGACCTTGATGGCATTGAATGATCACGCGGTTGGAATAACTGTA
CAAGGAGGAGTGGCTCGCGCCAAGTTTCGTTCATGGCGCGACCTAGTGTTTTATATCGATGCGTGCAAATCGAATTTCCTCCTGACTGAGAGCGAGCAAC
ATCGATCGTCGCAGGTTTTGATTCAAATGAGCCACCTTGCCTGGCACTTAGTGTAGGATAGTCAAAATGCAATTCAACACTCGAGCAGGCGATATAGCGA
AGCAAGGCGGAGATCCAACTGAACTAAGTCCCTTATGTGCATCTCACCTTGTCACTTGCTTTGACGATGTGTCCGAGAGTCCGGTGTGCTCGCCAAACGG
ACAACACTTTTCGAGACGGGATCATGCTCTCAAGCTGCTTAACATACCATTGCCGTCGATATTTGGTCAGTTGGCAGGTTGATCAAGGCGACCAAGCCAA
GATGAGTGTTCGTAGAGGGTATGAAGTACAATGACCCGATGTGACTCATTCCGATCTTGAATGGCGCTGAGCCAGTTGCTGAACGATCGATTGTTGTCAC
CATGCTGATCAAGCCGCGACGGCGACATAAAGATGTCGTCGCCGCCGTTGACTCAACAGACCGAAGCGCTCCCGCTCTCCTGGCTACCTTCAAACGGCCT
TTGCACATTCCCACGCGCTCCAAACCGAGACACCGAACGGCGCTAATTATGGCCGTGAGATGGTCGACATGATACCGTCGATGCAGACATATATAGCAAT
TGCGACCATCGTCACAGTCGTCGGCGTCATTGCCCGATCCGCTCACCGCGGCCCGTTCTCTACGCTTCGATCCTCGCTTCACGGTACCCCTCACGATGAA
CCAGACAACCCAAGAAGCTGTCACGACGCCTGGCCTCGCGCTCTCGAGCGTTAGTCTCCATATCGAGAGCCTCGTTCCATTGGCGTCGTCCTCATCCCAG
ATCAAGACATCTAATGGCGACGTCAAGACGCCAGAGTCGCTAGTGGAGTCGCACGATGCGTGGATGAAGCTGCAGGTGGCGGATCGGATGCAATGGCGGC
ACGGGTTTCGCTCCAACAAGAAGGGCGGACTCGTCTTCTTGGACGCCGACGCGCTCAAGAAGCAGCAGGGCGTGGTCAAGGAGATCATGCTGCAGGTCGG
CGCGCAGCTGCTCAGTGGCAAGCTGGCCGTGCGCATCTCGCTGCCGATTCGCATCTTCGAGCCGCGCACGCTGCTCGAGCGCGTGGCCGACGGCTGGAAC
TACGCGCCGACACTGCTGACCAAGGCTTCGCGACCTGGCACCGACCCGGTCGAGCGACTCAAGCTCCTGATGGCGTTCGTGGTCGGCGGCTTGCACTTCT
GCGCTGGCCAGCACAAGCCGTTCAACCCGATCGTGGGCGAGACGTACGAGGCGACGTACGCGGACGGTGCGCGCATGGCGTTCGAACACGTGAGCCACCA
CCCGGTCAAGTCGGCCTTCAGTCTCACTGGGCCGCAAGAGCGGTACCAGCTCTCGGGTGCGTTCGAGTTTGAGGCCGTCTCGAACGGTAACGCCATCACC
AACCACCAGATCGGCACGGTCAAGATCGCCTTCCGAGACGGACAGGTCGTGACGTACACGATGCCGCAGATCAAGGTGAGCGTGTTTGCATTGAATGTCT
GACTTGAGAGGCATCCTCGCTCACCTCAACGTTCTTTGACAGATGCACGGGATGATGTTTGGCGAGCGCGTGGTCGAGATTGTGGGCTCGGCAGTGTTCG
AGGACCGTACCAACAACCTTCGCGGCGAGCTGCAGTTCGACGCCAACAACGGCCTGTTCAAGAAGTCGCACGGCGACGACATCAAGGGCCAGATCGTCGA
CACCAAGGCTGGGCACAAGCACGCGATCGCCAAGGCTCATGGCTCGTGGCTCACACACCTCCACTTCAACGAGAAGCCGTACTGGGACGTCGAGACCGAG
CCCATGTTCGAGCACACGCCGGTGGCCGACGCGCTGCCGTCAGACGTGCGCTTCCGCGAAGACGTCATCGCGCTTAAGGTAGGCAGCCTGGTGTCCTCGT
CGTGCCAGTGCAGACAAAGCGACTGACTTGTTGCGTGCTGCAGAACGGAGATCTGGTGCTCGCACAGTCCGAGAAGCTGCGGTTAGAGGAGCAACAGCGC
GCGGACGGACGGCTGCGTGATGCCACCAAGCCACAGCCACACCGCAAGCACTAGCCACGGCCCAAGACGACAGGGTCAATCGCTCTCTATATTGGTCAGG
CCATTAGGCGTGCTAAAGGCAACATGAACATGCAACCACCCTTGCTCTCGTCGGCACACGGCCACCGGAGACGGGGGATCATTCCTTCTTGGCGAGCTTG
CGGACCTTCTTCTCGTCCTCCTCGGCCGCGTGCTGCTGCGCAAACTGCTCGA