Description :
From Genome Similarity Track
Location :
Scaffold_630:5989- 7208
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_630-fgenesh-gene-0.1DEAD/DEAH box RNA helicase

Sequence
1219 bases(100 bases per row)
GCCGTGGTTTTGGCTTTGCTCGTCCCACGACTGTGCAGGTCAAGACCATCCCGCAGGTGCTCGCCGGCAAGGACGTCATGGTCAAGAGCGAGACGGGATC
AGGGAAGACCCTGTCGTATCTGCTCCCGATCGTTCAAAAGCTCCAGTCCATCGAGCCTCGCGTTGGCCGAGACGACGGTTGCCTCGCGCTCATTCTAGCG
CCGACCCGAGAGCTGTGCCAGCAGATCCAAGAGACCGCCGAGAAGCTCACCAAGGCATTCGTGTTTCTCGTGCCGGGCATGGTGGTTGGTGGCGAAAAGA
AAAAGTCGGAAAAGGCGCGGCTCCGCAAAGGCATTTGTATTCTCATTGCCACGCCCGGCCGCCTGGCCGACCACTTGGTCAACACGCAGTCATTCAACTA
TGCGCGGCTGCAATTCCTCGTACTGGACGAGGCCGATCGCCTGCTGGACATGGGCTTCCAGAAGCAGATCACGCAAATCCTGGAGATTATTGATGCGACC
ACCAAGCAAAACAAGTACACGGGTGGGCGACGCCAGAACCTGCTGGTCTCGGCGACCATTAACAGCGGCGTCCAGGAACTCGCGCGCATGAGTCTCGTGA
ACCCCGTCCTAATCGATGCTGACTCGGAGGTCGCCAAGGCCACCAAGCAAGACGCCTCACGAGGAGACAAAGAGCAGTTCAACACGCCGCACCAACTGCA
GCAGCACTTTATGATCGTGCCAGCAAAGGCGCGACTCTGCGGACTCTCCTGCTTTCTGCGGCAAGAGCTGACGTCCAATACGGCCTCTCGGAAAAAGTGC
AAGATCGTCGTCTTCCTCTCCACGTGCGATTCCGTGGATTTCCACTATGCACTATTTCAAAAGTGTGCGTGGCCCGCTGGAAAGGGTTCTAAAGCCGCGC
TGGAGGCCGACGAGACGGCGGAGAAGCGCCTCGGCGCTGCGTCGCCGCTCTTTGGCTCGCTCGGCTCGCTGTTCCGGCTCCACGGCAATATCCCGCAGCA
AGAGCGTACATCCACGTTCAAGAACTTCTGCTCGGCGTCCAGTGGCGTGCTATTCTGCACGGACGTCGCGGCGCGTGGGCTCAACTTACCGACGGTTCAG
TGGATCGTTCAGTACGATCCACCCACCGAGACCCGCGATTATGTCCACCGAGTTGGCCGTACGGCGCGGAGTGGGAATGAAGGCAGCAGCCTCCTGTTTC
TGATGCCGTCCGAGTCGGA