Description :
From Genome Similarity Track
Location :
Scaffold_518:5988- 9139
Sequence
3151 bases(100 bases per row)
GTCATCGCGATTATTGCTCCGGGCTCATCACGGAGGCCAATTTTCGGGCACTTCTGAGGGCCCATCCATGGAGTGTGTTTGAGAATTCAGAAGATCCTCG
TTCTTTCGAGATGAATGTGGGCGGCCGACTCAAAATCCTGATTCGCGAATACAGTGGCTTCGACGACACCCACTTGATGGCCTTTTGGGAGTCGACACAC
CACTTTCCGATGCCGGACGCGATGGCCAGGAAGCATCCGTGGCTGTTGGTATTTCAGAAGGAACGCAGTAATTGTCGCTCATATGCTGGTCAAGCTTGGA
AACAGTTTCTCGAGCTACTGATCACCGTCCTGCGGGAAGGGTGGTGCGACTTGGAGATCCTGCTGGATCCCCATTTCCTGCACTTACCCAAGCGCGTGGA
GTCCGTCACGTGGTACCCCGGGATGGCCTCTCACCAGGCCAACTTGGCAGATCCCAACCTGAATCGTCGAGAGCCGGCGGATCTCCTCGAGGCACTGGTT
GAGTGCAACCGCCAAGATCCATGGCGCAATCACTATCGCGACACTCCCCAGTATCATCCGTCGCGCAACATCGCGCGCCTCCCTACCAAGTTCTTCAATA
TTCGTGCTGTCGGCGATCAGTAAGAGTTGGATCCAGAGCGTCTACTTTCAAGCACGTCCAAGTTCAGATATCTCTACAGCTGAGCAAGGTTTATACGGAC
ACTGGATCTGCCCCTGCATGCCGAGATAAGTGGTAATACACTCAACTTGTCGTCGTTAATCTCCATCTTGCCAGTTCTGCTTCCCTCCCAATCCACCTTT
CCGAAGCCCCTCGGTCGCCTCGTGTTGAGGCGGCCACGTCCTTCTCTCGTGGTCTTGATCCCCATGCGCACTTCGATCCAGATCCAGACTCTCGCTGGAA
TCCAGATCCAAACTCACACCCCGATCAAGATCCAAACTCTTCTTACCTTGTTCAGACGTTACGCTTGATCAGCCTGATTCTCACATGTACATATGCAGAG
TTCCCAATCCACCCATCTGCAACCACCTTGCAGATTCGTCGTCAAAATCCTCCACAGAGCGACCAACTCGCTCTTGGGGATCTCAGTCTCAACCTCCTCG
TGAAACTACATTACCCCAAACCGGTTCCGGTTGGAGCGCCCCCGCAAAAACTCATGCAGTATGGCTCCACAGTTCAGATCCGCCTTGTCCACCCAGGATG
GATCTTCATATCCACGCCAGTGTACAAGGAATTCACGGTGGATCCGGCCGTAACGAGTACGCTTTCCAGTCCACATGTCAGTAATTTTCTCCACCTCGTA
CTCGTTTTCATCCAGATCCTGGATCCAACTGTCCTCTGGCAGCAGTGCTTCATCAAAATCAAATCGATCTGTAGTGCCTTCAGTCAACTGGATCTGGGGT
CGATCCAGAAAACTCCTCGCAAGCTTCAATTTGGACACATGCATCACATGGAACAGCCGATACTCTGTGCCTGGAGTCTCGATCCGCACAGCGTGTTCTC
CGATCTTCTCCGCTATACGGAATGGTCCGTGCCACATATGGGCCAATTTGCGAGCATACCCTTCCTTCACCCGGTCCAGATACAGCCAGACCCTGGATCC
TACCTCAATCTGGTGCGGATGGATCTCTTCGTTGTGCCGGTCTGCCCGATCTGAGATCGCCCCCTGCAGTCGCGTGTTGACTTCTGCCCGTGCCTGCTCA
TAATAGCGTTGGATCCGGTATCTCCACCGCCGTGGATCCCGATCCTGGCGGCGAGTACTGCCTACCGGGATTGTGGCTTCGAGTGTGGATCTCGGATCCC
AGCCATGTACCAAGTAAAATGGCGTTTCTCCTCGGATCCGATCTTGGGCAATGTTAAGTGCGAAGGTGAGACGCTCCGCGTAATCGTCCCAATCGCGCTG
ATCCAGATCGTGCACATACATCTTCAGAGCGCGAGTTGCTGTTTGCATGATGCGTTCGGCGGTTCCATTCGCTTGCGGCCAATATGCCATCGTTGCACGT
TTTCGTTGACCCAGGATCCGGTTGAAGGATCGAAAGAAGTCCGACATGAACCCCGGCTCACGGTCGTGCCGGATCACTTCGCTGGCACCGAATCGTCTGA
AAACACACTCTTCGTAGGACTCCGCGATTGTCCGCGCTGTTCTGGAGTTACTGGCCTTCGCGATCACGTATCCCGTGAACAGATCGACCCAGATCAACAG
CTCCGTATTACCCTTGTACGACTTGGGCGAAGGTATGTGATCCATCGCTATGATCTGGAACGGGTATGTCGCCTGGATGTTTCCCGGCGACTCGCCCCTG
ATCGTGGGTCGTCCTTTGCCGGTCTCGCAGTTGGCACATTCGCCGACGTACTTCTGCACACTTCTGAAGAGACCTCTCCAGTGAAAGTGATCGCGGATCC
GCTGGTATGTACGCCCGATCCCTTGGTGTCCACCTTCCAGAGTGGAGTGATAGTGATGCAAGATGTCTTGATGTAGCGTCTCCGGCGGTGCCACCAGTCT
CATCAGTCCATCTCGATCTGCATCCGATCGCTTGGAGGGTGGGCAATAGAACAGCAGATTATCACCGTCGATCTCGTAGTCCGCTGCGAGGTTGCCATAG
GATCGGGCCTCATCCTGTGTCAGATCAGCCACATCTCCCCTCAGATATTTCTTCATACCCGCGATCCACGTTTCTTCATCCTGTGCTCGACGAATCCGAT
CGATCCGCAACCCTCGCACGAACTCCTCCTGCATGACGGTCGGGTTCGGCCGTGATCTGGTGCCCGATCGGGTTGTCATCGGCGGTAGTCGGGCGATCGA
CTCGTCCGACCGGACGACCAGGATCTCATCAAGTCGGTTCAGTGTCACTAGATCCCCATGATCGGCGTCCTCCTCCTCGACGGCGCCCCCTTCACGTTGG
AGTGCTGCACTGGCCAGGCTGTCCGCACTTCCGTTCCAGTCTCGTTTCACTTGTAACAGCTCGTGATCTGGCCAGTTCCGTAGCTGATCCAGCATCTTCT
GCTTCAACAATGTCAGCTTAGGTGCTTTGCAGTCAATCTCGCCCCGTACTTGTCGGATCACCAGGTTGGAGTCACCGCAGACCACTAACCTGCCTCGATC
TATGCCGTCCAGGAGGTCGAAACCCAACAACAGACCATGATACTCCGCCTC