Description :
From Genome Similarity Track
Location :
Scaffold_126:59873- 61094
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_13770branchpointbridging protein putative

Sequence
1221 bases(100 bases per row)
GCCTACAGCTACAAGACGCCGACGCTGAGCGCCAAGACGGACGCGGCCAAGAAGGAGTAGGCGTCTCTCATCCAAATAGGACTGGCATCGAACGTGTTGT
TGATTCGTTGCAATGGAGGAGATCGGACGGCGAAAGCCGCTGCAGGTGGATGCGGCCTTGAGCGAAGGGTCGGCCAACCATGCAGGAGGAGCAGTGGTGG
GCGTGCGTCCTCAAGCAACGGACACGCCATGTACCATGTATTACTAGTACTACATATTAGGAAGAGGGCATGCATCGTCTTGGCGCGCAATCCTCGGCAC
GGCGTTTCTATTGGTTGTCGCGGTCGAAACAACGACGGGGTAGATTGATAGATTGATATTTTTCGCGGAAAGAGCGGTCTCGTCGTTCGACCATGATACT
ACTACATGTGTCGACAGCGTTTTCATCACAGGGACGTACCTCTTGGTGCTGTAGAGCGGGGCAGTAGGCCTTCTCGTCGTAGAACCCTTGCTCGCCCCAT
CGTTCACGAGATTTTGATCGTCACGGTACGTTCTTGCAAGGGTATATTTCGTCCCTTGGTTCTTGCCGCCTGGACAACACTGCACATCGCCGCTCTGGTA
GTTCTTCTAGACACTGTGCTGGACTGGCCTCGACAGTCACAATCACAGGCTGCATCAGCAATGTCCAGCACTAACTACAGTGGTTGTTCGCACCGTGGAC
AGCGCATTTCTAGGCTACCAGACCCTCGGCTTCTGACACGCTGCAAACGCATGGAACACTGTTTCAAGCTCGCATCTGTAGCATCGTCCAAGGTCTATCG
ATACTCGCCTTTATGCCGCCTCTTAGCGTTGATTTCCAGCGCAAGAGCGTGCACTTCTGGAACGCCACGTGACTTGCTGGAAGCGTGTACTTTTGACCGT
ACAAATGCTGCGGCAATGTGAGAAAGGGTGCACTGGTCCAGCTCTTTTCTACTCAAATAGTGTTATGTTCAATTGGAGGTCTTTTGCCTCGGGCGAGAAC
ATCGTAGCAGATGACACGCCTCGACTGCCGCTTGTGAAGCACGCTTGCATTCAACGTTTCAAGGGTTTCAACTCCGTCTTCGATACGCTACAATATCTGT
CCAGAGCGTGGAAGTGACCACGTATTACACTATTTCAGATAGAAAGGCAGCGTTGGCAATGGTATCCTATGATTGCCACATGTGATCATGGAAAGCTGGC
GGTAAGGGCCCACCAGATTGC