Description :
From Genome Similarity Track
Location :
Scaffold_5:5985- 8250
Sequence
2265 bases(100 bases per row)
ACTCGGGCCTCCGAGTATAGATTAATCTTAATAAAAGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCC
TCTAAATGTAATATTCTAAACTGAGAATCTGTCAACGGCTGGTTGGCGGAATTCCAATGCTATGCATGTCGCTCATTGGCTAAAAGATGCTGCTTTCAGC
CAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGATCGTAAATGTATGTAGCATTTGGTGTATCTACACCAAGGACGAGAAAGTCTTTCGAAC
CTCTAACAGAGGGGGCTGCGAGTTGCGGAGCAGGGGCCAGAAATGCCGTTTTACGCCGGCAAAAGGGACCGCCGCGAAAACATGTCTGGGCCCTCTCATA
TCGAGGTTGTAGCGGACGTAGATGATCACGCAGGTGATTTAGCTGGTCATAGTGCTATGAAGTGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTT
GTAACTCTAACAGACACGGCCCCTCCTGCTAAATCGGAGCCCTCCAGCGAATCGGGCCCGATGTATCGGATCTTGGACCACCCGATTTGCCAAAACGGAT
GAAAGCCACAATACTAGCGTAGCGAACACGCTCTAAGAGCATCTCCACCGGTCAACAAAAATTTTGGCAATAGAGGATGTTAGCAAATTGGTATTTTACG
AGTTGGAGACAAAGACACTCTACCACCGCTCTCTATGTTCCCGAACTCGTAAGAGGGGAGTCGTGTTAGTACGGAATCTCCCGAGAAACTCGTAAGGCTT
TTTCGCGAGACTACAAGCCTTCTGATTGGCTCGTTACTCCCATCCTGCATCTCCCCCTTGAGCACCATGGCCGCCATGGCGCTTACAGGTACATGTAGCA
CCGCGACTCGAATCGAGTCGCGGTGGTTCGAGTCACTCGAACCACCTCATCCAGTCTCAAGTGCCCCCCCCCCCCCTAATCCGTGTGACGTCCTTGCCTC
TCCCAGCGAGGCACACAAGGATGACGACGATTCGACTGCGCGTCTAAAGTCATAACGGCGCGTCGAAGTAGAGTAGGCAGCCATTGACCACAAAGAGCAG
CATAAAGTAGAATATGTTGCTTAGAGTAGTGATGTCCGAGTTCCTGATCGTACTATTCGTTTGGGTATGTCAATCTAAGAAGCTGCATGGCGCCTCGATA
CTGTAGCGTTTGATTCTATCGCGGGTGATGACGTCGAGAAATGTAGCGCTGCGCTGAGCGCGCGAATCTCATCCTCGGTGAAGCTGAAGTACCTCTTGCA
GTACGCATCGCTGTGCTCGTTGAGCCTCGAACTCCTGGGATGATCAGTCACTCGGGGCTCTCAGAGCGCGAAGCAGCATCGCAGGAGGGGAGGGGGGGGT
CTGAGTGTCGGTCCGTTAGGTGGTTCTGCGGCGAGGTGAGTCCAGCTAGTTCGGCACCACAGCAGCGGAGTTTTGAACCGTGAGCACGGGGGGGTTGGCT
GCTGCAGCGACCGAAAAAGCTGAACTGAGGACCGCGACACCGCTCGTAGGTGGTGGTCGTACGAGCGCTCTGTAGTGCAGACCACTCATCATTTGCACCG
CGTTTTCATACAACTTTTCTTAGGATTACTCGGAGAAATTAATTTTGTGGCAACGTTGGGTGCCGATGGTCGATCAATATCTAGTATACATCATTCAATG
CGGAAATTTACATACAAGTTTTCTTATGATTACTCGGAGAAATTATTGTGCTTCGCAATGATTTTGCCGACCATTTTAGACGCTAAATATGGCAAAGCCT
GCTCCTATATATGTGTGAAAGAAGATACACGACTTGCTAAAATTATGCATAAATCCACCTCCTCATATATATATCGACTTGGGAGGGCCTGTCAGCAGCC
ATAGACACACGGCAATTATGCATAAGAGGTTGGATGTGCTGAGGATCATGGACGGTGGTGTACTGGGCCAATCAGAGGTCGCAAACGGCCAGCCGTGGCC
GTACGGATAGTTTTTGGCCGTGGCCGCGGCTGTCCGGCCGGACACCACGGCCGGCTGCGGATAACCGAGATTCATTGCGATATCAACTTTAGCTGTTCTA
GCTTCGATTGTTATAGCCAAAAGGACTGCTCTTGACGTTGACAATGAGTATTGTGGCTAAAGGAAGCGGTATTGAGTCCTCCAGCGTTGAATAATATTCG
TATCACCAGTCAAATGTAGAAATAGCTTGGTACGAAAAAAAATAAGCTGTTTTACGGCCAACCGA