Description :
From Genome Similarity Track
Location :
Scaffold_10:598381- 606523
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_04039Hypothetical protein
Sappa_CBS223.65SPRG_04040Adenylyl cyclase, putative
Sappa_CBS223.65SPRG_04041Hypothetical protein

Sequence
8142 bases(100 bases per row)
AGCTCAACCGGCGGCGCCCGGACACGTACATCATCACGCAGCTGTGCCACGACCTCGGGCACGTGCCATCGAGTCGGCGCGCGCGCGTGTGGCAAGCGCT
CTTGCTGCCCGGCGGCGCCAAGTCGGGTGAGTGCGATATCTTTGGCCCGATCGACGCAGACGATCCAAACCAGCGCGTGATCCGCGCGGACGCGCCTCGA
ACGCGGCCCAAGGACTTTGACGCGCGCGACCGGTCCGGCCTCGAGCACTGCCTTCTCCACGTGCTCACGTACTACTGCAAGTGCAAGACGATTCGGTACA
AGCAGGGCATGAACGAAGTGCTTGCGCCGTTCGTGCTCCTCTTCGGCCTCGACGCGCACGCCGTCGTGTACCAATGCTACTACACCTTCATCGACAAGTA
CCTCACCAACGTCTACTCGGACCGCGAGTTCCGGTCGCTCCAGTGCTCGATGCGATTGCTGCGGCTGCTCCTCCTCTACCACGACCCGCGGCTCTGTACG
TCTCTCTTCCATATCGAGGCAACGTCTTAGGTTGCGTGCAGGTAGCTACTTGGACGAGCACGATATGACGCCCGAGCTGTACGTGACGCCATGGTTCATG
ACGCTCTTTGCACGCAACACGGCGCCCGACGTGCTGTTCGCGCTATGGGACGCGGTCTTGCTGCACGACGACCCGACGCTGCTGCACTTTGTCGCCCTCG
CACTCCTCCAAGACCAGCGCGACGTGCTGCTGCGCGCCGACCCCGCCGAGCTGCCGCAGGTGCTCACGAGCCTCAGCATCACGAGCGTCGACCACGCGTC
GTCGCTGTTGACCAAGGCGCTGCAGACCATGCACATCACGCCCACGTCGTTCCGCAAGGACATTCTCTCGGTGCTTTATCCAAATCTTAGCGGCGCGCTT
AGAGTCGTGTAGGTGTGCTATCGCCCACTCACGGACCGAACCGTCTCGGCGCTCAAGCAGATCGGCGCGACGTCGTGTCTGACGCTGCACCCGTCCGAGC
TCGTGTCGTACATGGCGCAGAAGGTCCAGGGCACGTTGGCCTCGAGCATGAACCTCATCATCCTCGACTGCCGCCCGTTCCCAGCGTTCCAGGAATTTCA
TTTGAGTCTCTCGTACCACATCGATCCGGACGTCGCGGCCAACCCTGAGGCCTTCCGCGTGCTCTTGGACGGGTTTAGCCGCATGAAGGACTGCCACTTT
TGCTTTGTCGGCAGCAAGGCCAGTCGCAGCAGCGAGCCAGAAACTGCGTCCTCGTCGCCGCTGACGGACCCAGATCTGGTCGATGACGTGGCCATCTCTC
GCTTCGTTGTCATGTTTCTTCAACACAACTTTGCGCACGTGAGCAAGGTGCTCGGCGGCCTCGACGCGGTCCGCGACGAGTTCCTCGCGACGCTCGACGA
CAGCGTTGTCGAGCAACTCGTCGTGGGCGAGTACGTCGACGACACGAGCGCGTCCTCGCTCAAGGTCAAGGCGAAGCGACTGATGGGGAAGCTCCCGACG
CAGTCAGCGCTGCAGTCGCTCCAGCGGCTCAAGAGCACGATCACAAAGCCGCCGCTGCTCTTTGGGAAGGCGCCGACGACACCGCCCACCATCGATGGCG
TCACGCAGTCGGCGCTCATGGTCGGGGACGACGAGTGGGTCGAAGTCTGCGTCAAGAGCAAGGAAATCCTGCGCCGCTCGTCCAAGTCGATGGCCGACGA
CTGGAAGCTCGTGACGTTCGAGGCCGGGAAGCTCGGCATCCTCTTCAAAGGCGTCGACCGGTCGCAGATCACGGTTGACAGCATCGTGCCGCGTGGCCAA
GCCGAAGCGGCCGGGGTGCTCGAGCGCGGCGACGTCCTCGAGACCATCGACGGCGCCAACATCCGCGGGCTCCGCTTCCACGCGGTCATGGAGATGCTCC
AGCGCGCGCATCGGCCCGTCTCGCTGCAGTTTAGCTCGCCGCCCACCCGGCTCTTGGACGTGCTCGACGCACTCTCCGTGCCGCCCCACGCGCCCTTGCT
GCTGCGCAACGGCCCGTACTCGCTCTCGATCATTTGGGACCACGTGCCGGGCGCAACGAGATACCAGCTGCAGTTTGCGCCCCAGTCGGAGCACCGCTTC
CATCCGTGGGCGACGCTGGCCGTCAAGAGCCAATCGGGCAGCGTCGTGGACCATAGCAGCGACGTGAGTGGCACGGTGGTGGGCCTCGAACCGGGCGAGA
AGTACCTCTTACGCGTGCGCTGCGGCACGCCGACCAACTGGGGCATTTACAGCGAACCGAGTGCGACGATGACGACGATCGAGACAGCGTCGTCGCGCCG
GCTCTTGAGCCCGAAGGCGTCGCCGAGCCACGGCACGTCGAGTCTCAGCAACATGGTCGTCTTCCTCGCCGGCGAGTGCCCGGACGTGGTCGAGTCGGGT
CTCTTTTACTACCGCGTCCTCCTCGGCCTTCGGGCGCGCGCGGGCCGTCGTACGATGCATCGACCGAAGCGATTGCGCTCGAGAAAGGGTCGCTCATCAA
GTGCGACGAGAAGATTCTGCGCGGCCCGCACGTGTTTGTGCGCCTCCAAGACTCGGATTTTTGGGCGTTCGAGACGACGGCCGACGGCGCGCCTGTCCTC
GAGCGGCTCGCGATGGACAAGGAGCCGCCACTGCGCCACAGCGAGAGCGTCGAGAAGCACATGGCGACCGCGCCGTCGGGCTTGACGCTGCAGGCGACGG
GGCCGACAACGATCGTCGTGTCGTGGGAAGCGCTTCTGGACCCGAGTGTCACCAAGTACTGCATTCAGTTTTCGAAAAACCGACTCGCGGCGCTGTGGAT
CTCGCGCGACCTCGTGCCGACGGAGAACTCGTGTGTGCTCACCGAGCTCACGCCAGGGACAGCATATGTCGTGCGACTCCGAGCGGGGTACGAGACGGGG
TACGGCCCGTACACGGCCACGTCGGCGCCGTGTCGGACGGCCGATGCCCCGCCCGAGGTCGTCTCGCCCGATGACCTCGACGAGAATAAGCCCACGAAGC
TCTTTACGATGAACGGGTGGATGGAGAAAGCGGCGGGCGCCGTCCAGCGCTTGACCAAGACCAACAGCAGCGACCAGCTCCCGGACGAGAGCGACGGCCG
CCCGGTGTGGCGAGAGCCCCCGCTCGTCATCAACGTCGACGAGATGAAGCAAGCGAAGGAAGAGTTTCAGTGGTTTCCCGCCAAGAAACTCGTTGAAGAC
GCCAGCCCCGTCGCGTGCGAGCTCGTCGTCACCAACGGTATATTCCATCCGAAATGCGTTCAGGCACTCGATACGTGGTGCAGGTTACCTCTTGTCGGTG
GAGCCCGAGGTCGATCGGCCGGGCTGGGGTCGCATCGACGAGCGCCGGCGACTCAAGCTTTTGACCAAGATCACGTCGCGCCGCACCGTGCCCAACTCGG
TCGTCTTCCACTTCAAGGTACGCGTCCATTCACAGTGATCATCGAACTTTGCTGGATGAAATACCATGGTGTAGCAACACGAAGACGACGAGACGGTCGA
TAACGTTGCGTTCATCGTCGACGAGCGGAGCGCGTGCTTGGAGCTTGTCAAGCAGCGCTTCATGGCCATCACGGCGCCGCAGTAATTCGACTGGTTTGAC
GCTTGCCTATCGTTTGAAAAAGTGTGTTTTTGAGAGAAAAGGGGTGTTTTTGAGATGCATCATCGACGAGCAAGCCTCCGGCGCCCGAGAAGCCGAGCCA
TTCGCCTCGAACCCAGCGCGACAAAGGAACGCAGGATGGATTATTATGCAGTCGAATTAGAGCTTGCGGTAGCCGGGCCAGTCGGGCGGTGCCACAAAGT
CGTGTTTGCCCATGTACTCCATGAGCGCTTCGGCAGGTCCGTCGTGGGGCTTGAGGTTCGCGAGGAGAAAGTCCAACGTGTCGTGTGCCTCACGCCACGC
GCCTATCGCGAAGTCCATCACCCAACACAATTGTAGTTGGTGGCGCACCGCGGAGGTATTCGCTCACGCCCTTCTCGAACGTCGACGTGAAGCCGTTGAG
GAGGCCCATTTGCAGCAGCGGCACGTCGGCGACGCCGCGCACGTGGCGGACGTTAGCGTTGACGTAGTCGCACGTGTAGAGCGCGATGGGTTTGGCGCAG
CCGTCAAAGAGGACGCAGTCGATGCAGCGGCAGAACTGCTGCAGTTGCGGCGACAGCAGGTTGTAGAACGAGTGCGACATGATGAGCGGGATGTGGTAGA
GCTTCGTCGTCGACTCGAGCGTCGACGCCATGTTGACGTCCGATGAGAGGTACGACGCGTCGATCTTGTACTTGCTTCCGATGCCCCTAGATCGTAGTGA
GCTTTACATGGCTGCTGATGCGCTGACCGTCAATGGCCCAGCCAACGTGGAGACCGTAGCCCATCTTGACCTAACCGCATGGTGATGAAACTCAAAATGA
AAAACGAGATGATTCTCTACCTGAAAGGGCGACTCAAACCGCGTTTGGAGCAGCTTGTTGGTCTGGTACGCTTTGAGTTTGGGCGAAATGTCAATGTCCA
CCATGGTTTTGAGAAACGCCATGAGCGCATTGTCCGCTGCCGTCGCGACGTAGACCTTGGACTGCGCCATCTTCTTGGACCCTTCTTCGTCAAAGAATAA
AAAGTCGAGTTCGGCGCCTGAGGTCGTCGTGAGGTGCGCCGGTGGCCGCGCTTGGTTGATGACGGCGACGTCCGGGGAGTCTTCGGGGATCTTCCACACG
AGGAGGAAGGCGTCGCCGACGTTCTTGTTGGCGTGGCCGTCGAAGGTGTAGGCGGCGTGATGGACAATGTGTCCGATCGTGTTGGTGAACATCATGACTT
GCTCCTGGAGACACTCGGTGATGTCGGTGAAGCGCCGAATGTCGCAAAAGCCAAAGACCGCATGCACCTTCTTGCCCGCGATGATCGGGTTGAACTCGGC
GCCCATCATGTTTTTCGAGATGATGGCCGAGCCCGCCGAGCCGTACCCGATCTGCAGCAGCCGCGCGACCTTTGTGAGCGTGTTCTGGAGCAGCTTCATC
TCGTACATGGGCTTTTCCTCGTCGACGGGCGAGACCGACTTGGTCGGGTTGAGCGCCAACTGCTGCGTCAACCTCACCTAGAACCCATTTAGCTCTTTCT
ATTGAAGCATTGATACAAAGCACCATGCGCTCGACCGGCAAGATGACGCGCTTGTACACGTCGAGCGTGAGAAGCATGCCACCACTTGCAAAGCACGAGA
TGATGAAGAGCGTGCGAACAATCTCCCAGATCGCCTGCCGACCTCTCAGACACGAGGACAAGAATTCGGCCGACGCACCTCGGACTTGGCAGCGGGCCCG
CCGTCAAAGATCGCGATGCTCTGGCACGGCATGTCGAGACGCGGCCACGTGCAGTTGGACGGCACAGCGACAACGTTGAGGTACTCGACGCGGTAGTTGG
CGACGACGGGCGGCGCATAGATCGCCGACCCGTTGAAGAGGACGGCGTCAACGGGCCACGGCACGTGGGCGTACGTTTGCATGGCCGCGTGGACGACCGA
TGCGTTGGCACGCGCAATGTGCAAGTAGACGGGCTGCGTCGCGTTGATGTACGCAGCGAGTTCCCGGCCAAAGAGACTATTGGGCGGCCCTTCGGCCCAC
ATGTGGAGCTTGGTGAGGCCATACGTGATGGGCGAGACATCGCGGGGGGTGTAGCACTAGGCTCATACTGTGAGCTGCCGTGTTTTATAAAAAACAAGAG
AGAAATGACCTCGGTGAGAATGATGAGCACGGCGAGGAGGAGGAAAATGACGTGGCGGATCGTCGAGTCGGCGACTTTCTCGCCGAGGCGACTCGCGTAA
AAGTTGAGCTGGCTGATCTGGTTCTTGCTGGTCATGTCTTGTTCGTACGCGTCCTCCATCGCCAGCAAGGTCCTCTGAAACTTGGCTGCCGACAACGCAA
AGGTGCGCATCGGCGCCGTGTTGGTGCTCGACGCGACGCGCGCGCAAAAGTTGTGGCGAGCGTCGTCCGGCGGCGGGTACCCGCGGTACGCGCCCCGAAG
CAATAGTTCAATGTGCTCCATCGTGTAGACCACCGGGCGTCCGTCGGGCGAAGCAAAGATGCGCTTGAGGTCCTCGGCCGAAAACGTCGCGCGCGGCCCG
TCGCTCGGCGGCGGCGGTGACACGGCGGCCGTCGACGTGCGCGTCTGCTTGACAAGCGAGAGGCGGCGCGGGCGGTACGAGCGCTTGACCATGATTTGCT
TGAACATCTTGAAGAGCGTGGCCATGCGCAGCATCCGCAGCATGCGCGCCAGGCGGAAGCCCGCCACCTTGGCGATCCTCGCGCCGCCCGAGAGCGAGAG
GTTGCCGACTTGGCCGTGGAAGCTAATGAACGGGACTTCGGTGAGGAGCGTCACGGACGAGACGAGGTCGAGCCAAAAGTAAAAGCTCCAGCGGTATGAG
GGTAGCACAATCGACGTCAAGAGCACGTCAAAGAGCATCACCGTAAGCACGAGGACGGTGCAGACGCCGTAGGCCACATCGCTGTGCACGCTCGTGCTGG
CAATGCGCACGTTGTCCGAGAAGGTCGCGTAGATCGACGCGAGGAAGAGACCGACGACAACGGCGTTGTGCTCGCTGAAGCGTGTGAGGCGCTCCATGAT
GCGCTCGCGTCGGCTCAGATGCTTGAGCTCGAGCGGCCGCGAAAGCGCGCGGATGAGCTCGATCTGCGGCGCCGTGAGCGCGCGCCGGCTCTCGGCCTCC
CACTGCCGACGATTCGCCTCGGCAATGTCTTGGAGAAAGCTCGCGGCCGGAAGGAACTCGGCGAGAAGCGACAGCGTCGGCTGCAGCATGAGCCGCACAA
AGTTGGCTTGGATCTCGGACGTGTTGATCTGGTCGGCGTTCCGGAAGGTCGAGACGACGAGGCCCTCGCGCTTCTCGAGCGCGCCTTGCTCAAAGAACTC
GCTCATGATGAGGTCGGTCCAGTGCTCGGCGAGCGTCCACTCCTTGGCCGGGTTGCAAATGTCGGCCGTGTGGAGAAGGTACCCGCAGTAGACGTACGCG
TCTTCTTCCAGCAGCGCCGACGACCCGCGCGGCAGCGCGCGCATCTTGCGCAGCAGCTCGCTATGGATGCTCACGTCCGTGTACATGATGCAGCGTGCGA
TCGTCTTGGCAATCCGCAGCGACTCCTAAATCGTATGGTCGCATGACGCGACAAGATACGATGGATGTGATCTGCACCTGCGTCTCGAGCGTCGCAAGGA
AGCCGTGTTGCTTGACGAGAGCCATCGTGCGCGCCGTGTGCATGCTTTCGAGCACTGGGTTGCGGTACGTGAGCGTGAGCGGGTGCCCGGCGTTGACGAG
GAACTGGTTGGTGAGGCCGACGTGGCCAATGTCGTGGCAGAGCGACGCAATCAGCAGCGCCGACGCGGTGCGCGGCGAGAGGTACGCGTGGCCGTGGAAG
CCGCGCAAGAAGACGGCGACGGTCTGCATGACGTCGACGGCGTGGAGAAACGTGTGGTACCGGCGGCTCACGATCGGCTGCGTCGTGCGCTCGACGTAGC
CTTGCTGCACGTCCGCGTAGAAGGCGCCGATGGCCTCGAGCGAGAGGTTAAAGACCTCGTGGAGCTCGAAGAACGCCGAGAGCCGTTGGACGAACGCGAG
CTGGGACGGCGGCGTCGAGAGCTCAAAGACGTTGAAGTTCCAGTTGGTAAAGTCGTCGCCGACATGGCCGTCGGTCGCGAGCAACTGCTTCTCGACCGCC
TTGGACGTCGACCGCCGGTGCTTGGGCAGCCGCGGCGACAGCAACATCGCGTCCGTCGAGCAAGTTGCCGTTTCCAGCAGCAGTTGCGCGTGTCAGTTGC
ACGCCTAAAATTGGCATGTGCCGCTCATGCCGAATCCTAGGGCGACCCAAGTGTCCTGTAGCCCGCTGTGTTGCTTATGCGGCATAAGCAACACAACCCA
AGCGCCCGCCGCTTGGGTTGTTTTGTTGGATCGAGTGTAGAATGTGAAATGTGAAAATCTACTTTTTGCCAAAGAAATCCATCAAATTGCTCTGCTTGGC
CGTGCCAGACGTCTTGAGCACGCGCTTCTTCTTGGGCGGTGGCGCCGGCAGCTTGGCCGACACGCGCGGCTTGGGGGCGACAGGCGGCGCGGGCTCCTCA
TCGCCGCTCTCGACGTCTTCGTACACGCTCTCGTTGACCATG