Description :
From Genome Similarity Track
Location :
contig_1:59836- 62707
Transcript NameFunction/comments
g8.t1ABG66533.1 reverse transcriptase, partial [Phytophthora sojae

Sequence
2871 bases(100 bases per row)
ATGGACAAGGATGTCCTGGACGAGCTTGGCAAGAAGCGCGCAACGCGCACGGGCTCTGCGATCCTCGAGAACCCCAAGGATCCAGTGTATCCTTTGGTGA
AGGAGTTCTCGGACGTGGTGTCCAAGGACCCGCCGTCCCAACTCCCACCTGACCGAGGAGTTAGGCACGAGATTGATCTCGTGCCAGGCACAAAGTACTG
TGTGACCAGGCAATGGCCACTGCCTCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAGGCAAAGGCAGGCATGGTGCGTGAGTCGAAGTCT
CCGCACTCGACGCCCACCTTCTGCGTTCGCAAGCCGAACGGGAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCAACGGTGCCCGCCCAGA
CACCCATTCCCCGCAAGGATGTGTTGTTGAACAACATGGCGGGCTGCGAGCTTTATAGCGCGCTGGATCTGGTGGATGGATACTACCAGATCCTGATGCG
CGAGCGCGACATCCCGCTCACGGCGGTGAGCACCCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCACAGGGCCTATCAAATGCCCCAGCGACTTTC
AATCGCTTGGTCACACAGTTGTTTAGACCCTTGCGTGCGTTCACGCAGACGTACTTTGACGATATCTTCGTCCATAGCCGTGCCGGGGAAGGCAAGACGG
CTATCGAGGTGCATCTCGAGCACCTCCGTCGAGTGTTTATGGTCATGAGAGCAAACAAGCTCTATGCCAACATCGACAAGTGCGTCTTTGCGGCACAAGA
GATCAAAGTTCTCGGCTGCTTCGTCAGCAGCGTCGGCGTTCGAGCCGACCCTGAGAAGGTCAAGGCCATTGCGGCCTGGCCCACACCACGATCCCAAAAG
GATCTTCGCAAGTGGTTGGGTCTCGCCAACTACTTGCACAAGTATAGTGCGGGGTATGCCGGGCTGGCACGACCCCTGTCGGATCTCCTTAAGAAGGATG
CCGACTGGCGCTGGGAGAGCCGTCATCAGGATGCATTCAACAGCATCAAGGCGAGCTTGCAGCGCGCGCCGGTCCTGGCTTTGCCGGACGAGACAAAACC
GTTCAGCGTTGTCTGCGACGCCTCCGACTATGCCATCGGTTGCGCGCTGCTGCAACACGACGCGGACGGGCACGAGCGAGTCATCTCGTTCCAGTCCAGG
CAGCTTAAAGCCGCCGAGAGGAACTACCCTGTCCATGACAAGGAGCTCCTCGCAATGAAGTATGCCCTTGTCAAGTTCCGGGTACACCTCCTGGGCTCTG
AGCCCTTTGTGATCTATACAGACCACGCGTCCTTGCGGACGGCCACCAACTCTCCGCATCTGTCTCAGAGGATGGCCCGCTGGCTGTCATTCTTCGCGGA
ATATAACTTCCGCGTCGAATACAAGCCGGGCAAGCTGAACGTGCTTGCCGACGCGTTATCCGTCGACCCGACTATGAGCTCGCGCACATTAGTCGGGTTA
CGACAGATCTGTACGATCGGATACGCCTGGCGTATCGATGATGAGAATCTCTCTCCCCATCGTGCGGTTCCTCACCGCTGGCAAGGAGGCCAAGCTGCAT
GGCTAACGCCCCGCCATCGTGCCCGCCTCCATCGCTATGCGTGGGTCGATGGCCTCCTCCACTACCGCGTGGATCCGGCCGATCCTCCGCGGATAGTCGT
CCCCAACGACGAGGATCTGAAGTATGACATACTTCAGGAGGCGCATGATGTGCCTTCCAGCGGCCACCTTGGCCGCGAAAAGACCTTCTTGTCAGTCTCC
CAGGTCTTCTGGTGGGCCCACATGTACAAGTGGGTCGCCACGTATGTAAGGACCTGCGAGACATGCCAGCGAGTGAAACCTGCTGGTCATGCCTCGGCTC
CTTTGCAGAGCCTGCCAGTCCCGGAAGACTGCTGGAAGTCGATGAGTCTTGACTTCGTCTTCGGACTGCCGGCTGATGCCCAGGGCAACACCGGCGTCCT
GGTGTTTGTCTGCCGCTTGAGCAAGATGGTACACCTTGCTCCGGTGGCTGACTCAGTCACCGGTGAACAGACTGCACGGCTGTTCCTGGATGGCGTCTTC
CGCTATCATGGCCTCCCTGAGACTATTGTCTCTGACCGTGACCCACGGTTCACGTCTGCGTTTTGGAAAACGCTGTTCCAATTGCTTGGAACACGGCTGC
TCATGTCCACGGCCGACCACGCAGACGGACGGCCAGACGGAGCGCGTCAATCGCGTCCTCGAAGACACTCTACGCAGTGTCTGTGCCGAATCTCCCGGCA
CATGGTCGGCCAGTTTGCCGATGGTTGAGTTTGCACTCAACAACGCGGTACACGCGTCCACGGGGTTCTCCCCGTTCTACCTCAACGGGCTCCGGAACCC
CCTGGTGCCACTCACTCTCCGTGGTGACACCGCGGCTTCGGTCGTAAGTGGGGGAGAGGCTCGGAAAGCTCTTTCCTCCCAGGTGTCAGACGTGACACCG
GCTTCCCTAAAGAAGCAGTTGTCGACTTTTGTCGACAACAGGCTTAATGTGATAAGCCGGGTGCGCGACACAATGGCCGCCGCCCAAGATAAACAAAAGG
AGTACTCTGACCGACATGGAAGAGGAAACTTAAACGTGTTTAAAGTGGGCGAGTTAGTCCTACTCGACACTAGGAACCTACCACTAAACTCGGTCAGTTC
CGTGCTCAGCAATAAGCTGAAGCACAGGTTTATCGGACCCTTTGAGGTCCTGAGCAGGCATGGCTCCGCCTACACGATCGACTTGCCTAAGTCGATGACC
CACCCGACGTTTTATGTGGGTCGTCTGAAGCGCTACCACGACCCTCAGGCTTCTGATCCCCCGCAGGAAGC