Description :
From Genome Similarity Track
Location :
Scaffold_53:59830- 63057
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16020ribonucleoside-diphosphate reductase small chain
Phypa_INRA-310PPTG_16021hypothetical protein

Sequence
3227 bases(100 bases per row)
TTTAAGTTCGTGTCTGGGATGAAAGAGTGGGTAGTCGTCTTTCGCCGCCCGCAGCGCGCCATGCAACTCATCACGTAGCGTGGTTAAGGTCTTAAGGTCG
CAGCGGCAGTGTATATAGCCAGCTTCGTTGCATATTTAAAAAAATATCTGAGATTCATTCGTCAGTCATGTGCTTGTCTTTCAATTGTTTTGATTTTAGT
GCTCCTCGTTTTGCTAGGGTAAATAAATTCAAAGGAGATTAAAATTGTTTCAAAGATAATGATCATAAAGAATGCAGAGCAGGGGCCTCGTTCAACGAGC
TAATGGATAGCCTTAACTACTCCGATCGCCCTGTCGAACTCTGAGATCGAAACTTCAACAATTGCTACCACTTCAACACGAAGGACCCAACTTGGATGTG
CATCTTTAAGAGATTGCTGTACGTTGGAGTTTTTTTGCTTATCTACATGCATTTCCGTTTATGGCGCGGAGAAGTTGGAACAGAGTGTTTTAGCGTGCAA
TTTATCTATTATACGTGCTTGTACAATCTCAAGGAGCAAGGGTGGTCTGTACGCTGCTCCTGTGCTATACAACGACCTCGCAAATTATGCTCGACTTTTT
CTTATGTCGTTTTCACTTATTTGGTGGCAGTAGGTGCCATAGATACCGAGTTCATAAAATCCATGTTCAGTCCCTCGTCCTCGTCATCGTCGTCGTCGAT
ATTGATCATGCTGCTCTCACGAGGCTGAACAGATGAACGTTCGCTGTAGCTTCCAATGGAGCTGCGAGTGAACTTGAAATGCTTCTTCTCCGCCGTCTCT
GTGCGACTGGCAGGCGAGTCGTCACTAGCTGGAGGCTCGCGCGCAGGTTGATCTTTCAGGCCCTCCGATTTATAGGAAGACGCAGTAGAAGAACCCACGA
AAGAGTTAAACTCTTCATCGTCGTCTCCTTCGATGTCGTTCTCAAAGTCATCCTTCACGACAGGCGCCGGTGTGGGCATGACAAACTCGTCGACCGAAGG
CGGTGACGGTGGGTCGCTGAAGGAACCAATCGATGAATCGTCATCACTGTATTGCAGCTGAGACTTCGCGTTTTCCGCAGGCGAGAGCTGCTGTGGCTGT
GGACGCGTTGGGCTGCGACGTCTGTTATCAGTTTGCTTCGTCGGACTGGTAACCGGAGGTGTATACTTTGGAACGGTGCTGCCGACGAAGCGGCCTTCTT
GATCGACGGGCATCGCATTCGACACCGGGTGGTAACTGGTGAATTCCTTGACGTCCAATGTATCGCGAATCGCCTCGTTCGTGGGTGATCCGGTAGCAAC
ATCGTTGGCAACACTAGCGCCCGCTCCCACACCTGTCGTGAGCCAGTCGCGAACGCTCGTGAAGGGAAAGCCACTGCACGTGGGGCACTTGGGAGTAGTG
GTGAAGGTGTGCGAGGCGAGCAGAGCGACAAAGTTGCGTAGTGCCTTCTTACGGTAGTTAATAACGACGGGCGTGACGCTCGTGAAGACGTGCTTGCGCG
GGAACTCGAAGAGCTTGAGCACCTTCTCGTAGTTGCGGCATCCTGGACACTTCTTGTCGGTCTTGGCAAAGAAGTCGATCAGGTCGTTGCGCAGCTGCAG
GAACTCAGAGAAGCGGCGCGGGGCCTCCCACACCTGACCGGAGCGGATGTTCGTGACACGCACGTGGTAGCGCACCTTGCCGTCTCCAGTCGAGTCAACA
GTGGGGATCTGAACGCGTACGAGACACTTTTCGTCCACACGGCCTTGCTCGCCGTTGCGCGAGTAGGCGTAGCGCGACGTGGGGTTCATCGTGATCTGTA
TTGACGTAGTGTGGCGTGGATAGTGCTTGGGAGCAAGTTGGATGATGAATGGCACATGATTCATGCTGCTCCATTTCGACGATCGGACGGCTAAGAGCTA
TGGAGCTCTTCGAGTAAGACGCGAGGGGCTTCGAGATTTTTAGCCAATCATCTGGGACCATCAATGGCATCTTGGTCCCACCGTTTGATGTTTCTTCAGA
GAGTCAGAATTTACTTGACTTTTGTATGTCAACGGTCAGTGGAAGCCGGTTCATGTTACCGATTTTGTGGCTCGTAGGAAGCACCAGTGACGTCAGCGTT
TCATTTTTTACCAGAACACGAAGACGTTACGGCTGCCGCGCAATGCTCGAGGCATTTGGCGTAATGATGCGATGGAAAGTCCATAGCCAACGACAACCGC
TAGGGGTATTTAGTTGACGAGCCACTTGGTCATACTCTCGGAGATTTCTCGACCGAGTGTTAGCAAGCGCAGTGGTTTCAGCCAGCGCTAGCGTCGCCTT
GTACTGACACAGGCTCGTTAAAGGAGCGCAACTGACGCAGTGATTTCTTGCTTCGTTGTCGCGCGTACGCTGTGCTGTGTCTGCAGCTGGGACTGAAGCA
GCTTACTAGCTCGTCGATCGCATTCGTTAAGCAGCACAGACGACATGCTATTTAATAGATGTAACTGGAAACTCTCGTTTCTTCAAGCCTAAGCTACAGG
TGTACACAAGTAATTGAAGCGCGGAGTGCTGTGATCTGCGCCTAATTGGCCCTTCAACGTAAGCTGAGCAGTATTCAGCTCAATCAGAGAAGTTCATACT
TGTATCAGATGTGATGGCAACCAAGGTAGTACCAGTACGTACAGACACGCTGTGGATAATAGTCACGGTGAAAATCGTGGTGAGATCGCTGTGTAGTCTC
AGAATAGGATCCATGAAGATCCCCGATCGGATAAGAAGATCTAAGATTTTACTGTGGTTACCACCACAGTATGGTATTAATAGCGTGTGGATGCACATTG
CATCTCACCTATGTGTTCATTTTACCTTTCCACACAAAAATTTGGAGTGCTCTCTGGCCAAAACTGCTTGCATGGACATCTTAAGCAAGCGTACAATGTC
ACATGCCAATCACTAAAATCGTTTTCTGCCGTATTATGGTTATAAGCTCCTCCACTTACTTTAGCAGGTGAGTGCATTTGCCTCGGTGTTAAACAGAGAT
CGCAGTAGTAACGAGAGTATATAACTTATCGGCAGCGAATGCTGTTGTAATGGATGGTTTCGAGAATGATATGGGCCTGTTTCGTCTGGAAGATGGTCTC
ATGCTTGTTATCGTCCCGAACTGCAGTGACAATCAGCACGACACCCTCCATCACTTCTCACAGTTACATTCCGCTGTAAAATTTGCTAAAATCCACTTTG
ATGCCTCCATAATGCGGACGACGACAG