Description :
From Genome Similarity Track
Location :
contig_9:59822- 61700
Transcript NameFunction/comments
g2734.t1hypothetical protein
g2735.t1POM63999.1 Mannosyl-oligosaccharide alpha-1,2-mannosidase [Phytophthora palmivora var. palmivora

Sequence
1878 bases(100 bases per row)
TTGGACGATTGCAGGAGGCCTTATCCGCAACAAAGCCCAAACGAAGGAGTGGCTGAATTCGTTGCTTCAGAAGGGAACGTCCGTCGACGACGTGAAGGGC
ATCCTGGGTTTGAAGGGCTTATCGTTGGAAAGTATGTTGAAGCACAGGAACTGGAATGCCTTTGACAGATATTGGCGGTTGGTGTATGAGAAGGGCAACC
GCAAAGAGATCCCGTACGCTGTTTTTGGATCGGGCGAGCAAACTAAGAAGAACACGCACGAGGTGCTTCTGGGGTGGGTTCTTTCCGGAAAATCAGTGGA
GGGGTCGGCAAATACCTGGGGGTGTGGGGCTTGCCAAGAGCGAGCAACTCCTCCATCAAAACTGGAGAGCGTTCAAAGCCTACCGTAAAATGTTCGTACA
ATACGAGACGGGGTTGCAGAAAATAAAGGACCAAACGCAGTTCGCGTATTTCGACAAGAGTTTTCGAGGCATTGACGAGGCGAAGGAGACGATAACGAAG
TGGGCCATGAAGGGGTACTCAATCGATTACATCGCCACGACGCTGGGCTTGTCGGGCTTGTCGGGGGCCAAGCTGACGAGCCACATCAACTACCGCGCGC
TTGGTCTGTACAAGAACGACTTTTACGCCTTGGCATCACTGAGAGAAGCTAATGCGAAAGCCAGAGCCAAGGCCAAGGCACTAGCCAAAGCCAGAGCCGC
TGCCGGAAACGCTTAACAATGATAAGTGAACATCGCCATTAGAACTTCTTTGAAAATGTATGTTTCGTACATAAATGCTTCATACTGAAACCAAGTGGGT
TGCCATTCTGAACCAAGTAGCATGGGGCGGCAGCCGCTGAAGGAGGGCGGCGGACGTAAGGAGCGCAAGAATGTGCGCACGTCCACGACGTTCGAGACTC
GACTGGCAGCGATCAAGCACTTCGAGGAGAGCGGCAACATGACGTCCACCGTGGATCGCTTCTTCCCGGCGCTCACGCCGGAGGCCAAGCGCAACAAGAA
GCGCGTCGTGTACGGCTGGATGAAGGACCGCGGCAAGATCGAGAAGGCCTGCGAGTCGGTGAGCACCGCCAAGGCGCATCGCCTGCGCAAGCCAGGTCTG
GGCCTCACGCTCAGCAATGACGCCGAGAAGTGCATCGTGGTGTGGCTGCGCTCACTGCTGAAGCTGGGCGTGCCAGTGACAGGAGCCATGCTGTCCGAGC
ACGCGCTGGAGGTGGCCAAAGAGCTGGGTATTGACAACTCATTATTCACGGCCTCCGGCCCTTGGAGGAAGAGCTTTCTCCGGAGGCACAATTTGGCCAT
GTAGATCGGGAATCGCCCTGACGAGCATGCAAGTGCCCACACGAGTGTATGAGAGGTTCTCCTGTGTTAATTCCATGTATTTTTTAACCCCAATATATGC
AGGAGGTACATACAGGGCGTTTGATGAGGTTGCTAGACCATACGTGGTGAAGAAATTCCTTTCCGTGTACGCAGAGCTTAGCTTATCAACAGTTCAGCGC
CAGCTCTGCTTCCTCCAACCGGTTGCGAAGTTACATCCATGTCGTCTTAATGAGGTGGTCCGGCACCTCAGCCTCTTTACCGGCGAGCGTGCGCGCGCAC
AATTCACCCTCACCCTTTCATCTACGTGTAGCGATCAGTCGTTGCTTTTTTGCGGTCTCAAATGGCTACATATTTGGCTATTGTTGTAATAAATTCAAAT
GGCCATCTTAACGGCTCAACACGTCACAGCAAACCTCAATGCTGCCGTCGTACTCGCCTAAAGGCCGCAAGCGCTCGCAGCAGCTGCAGCTCTGGAAGCG
TGTGGGGCTCATCGGCGTCGTCTGTATCCTGGTTCTGTTCGTCTGGGTGCAGTACACTATCGTCACCACGAACTTGGG