Description :
From Genome Similarity Track
Location :
Scaffold_10:5982- 19838
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_10-snap-gene-0.11Ubiquitin ligase E3 alpha-I
Pytiw_DAOMBR242034maker-piw_contig_10-fgenesh-gene-0.6Flagellar associated protein
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_10-abinit-gene-0.37Phosphomevalonate kinase

Sequence
13856 bases(100 bases per row)
AGCAACAGACGCTGCTGCGCCAGCGCGAGGAGCGCGTGCTGCAGCTACTCGCGTTCACGGCGCAGTCCGCGCTCGCGCTCATGAAGATCCCCGACGGGTA
CACGATTGGCAGCGTGTGCAATACGCTGCTTACGGCGCTCTGCGGCACGGGCAAGGACAAGAAGGCGACCCCGCAGCAGATCTTGGAGAAACTGACGCGC
AACGTGCGCAAGCGCGTCTGCGGCGCGATCTTCTCGTCCGACGAGATCGCCTACAGCTGCCGCAACTGCCAGGTCGACTCGACGTGCGTCATCTGCCAGG
ACTGCTTTGCGCACAGGTACGTCGTCGTATTTTTGTTTTCGTATCTTTCCGTGTACCCGTTAGAGCCACATTGACCAACCCTTCTGCGTATATGTTGACT
CGTCAGCGATCACACGGGGCACGACGTATATTTCCAGCGAACGACTGCAGGCAGCTCGTGTGATTGCGGTGATCCACATGTACGTAAAAAAATGTTTGCC
GTTGTGGGTTGAGTAACAACGAATGACCTGGATGGCATTTATTTTTCGTCTACTAGGCATGGAAGCCCAGCAGCTTTTGCTCCAAGCACCCAGGTATCGA
CGACGCGGACGCCAGCGTGTCGAAGAAGCACAAGTTGCCCAAGAACGTCGGTCTCGCTGCACCAGTCGTGGTTGACGCCGTCGTCGACCACTTGTTCCAG
TTGCTCCTGGCTGCACAGCAGGGCTTCGAGATGGCCGAGGCAATGGAAGTGTTTTCGCGCGACATATCGCCGCAGATCCTGAGCGAACTTGCCGTGGATG
TAGGCGACCTGGCTGTGAATCCCGTCAGTAGTAGTGCCAGTGGACGGCCCGCAGCGGTGAATAGCTCTCGTGTGTCGTCGAGAAACGCGAATGCCGTCGC
TGCGCGTCGCGGGCGGAGCCGAAGGACCTCTCGCGGCTCGGAAGCTGACGAGTCCAAGACGGAAAGCGTCATTGTCAAGATTGTTCCCACTGCGGTGACC
GCTGGCCCTGCTACTGCGAAGTTCGTTGTGCGACTTCAGAACGACGACGTGCACACGCTCACGGAAGTGGTGGACATCATCTCAAATGTGGTGGGCGTCT
CCAAGTCGATAGCGCGTGATATGGTGGACGAAGCTGACCGAGTTGGTGACATTGCTCTCGAGACCTACGATCTGCTCAAGTGCGCCTCGGTCGCGGGGAG
CCTTGTCCGCAGCTCGCTCAACATCAGCGTCACGCCTGACTGGTGGTATTCACGCATGGAGAAGATCTCTGATATCATCCAGTGGCTCTTCTCGCTCAGC
TGTGCCTCGGATGGTCTGAACGAGATTGTCGCGGAGGCACTTTGCAAGGAACGCACGCCGATCGTGAAGGGCTTCGAGTCGCTCTCTAGCATGCTGCGCG
CGGATGGGAAGACTAGCAGCAGCATTGAGGATTTCTTCAAAGACCAGCACGCGCGCGTGAATGGCGCTGCCGTGGAGCTATTTGACGCAGTGATTGGTGC
GAAACCACTCGCGGACTGGTCTCGCGAGTTGGAAATCGAGCAGCAGCGCATGCTTACTTTCCACTCAAAGATGTCTGGAGACGAAGCGCCGAGCATCGTG
CGAAACACGAATGGCGATCTAGTTCGCTGCGAGAACATATTTATCGAAGACTTTCTCAAGTCCGTCGCGCACAGTAAAGCGTACTCGCGGCATCAGAGCG
TTCGAGACGGAGTCGACGCTGTGGTGGCGAGGTTCTTCACGTCGGCTGAGGACGTGACGACGCTCACTGGACTGACGCTGCTTGTCCAGTACGACTGCAT
TCTTCGCAAGTCAGCCGTCAAAAACTCACACCTGCTGTTGCGCGAGCACATGCTCGGCTCGCAGTTCCGGACGGAGATGCTCGAGTCCTACGTCCGGTCG
TACAAGGCGATGACGACGAACTTCCTGCGCGGACTTGGCAATTCAAACGACACGGTGTTCGACTTTGCGGTCCAGTTCCTCACAGTGCCGCATCTTGTGA
AGAACTACACGCGAGAGATGACGCGACTCCATCCAGAGCGTCCGCATCTCTTGGGTGAACTGCTCGCGTCGTTGGAACTCGTGTTTCGATCGGCTATCAA
CCCGAAGGACGGCATTCTGAACGTGGATCATCCAGCGCTCGGCAACCAGAAGTACAAGGTACGCCATATCTTTCTTTTCTTGCCTCTGTATGGGTTGACA
GACAGGATTATTAACCTGTGTCTTTTTTTGCTACAGCACTGTGTGGACAACATGGAATACGTCCTGAACATTGGCGCGATCCCGAACGAACTGGTGTGCG
ATCTCGAGAATCTGGGCGTGTGGCTATCGTGTCTGCAGATTTTACAAGTACGTATCCATTTATTAGAGCAAATATTGTTTGTTGGACTCGGCTGTGACTG
ACTATTTACGGTTTTATTTGAATTTTCTGTAGAATGGCGATTTGCAAGCTCGTAGAGGCATTCGTGAGACTCATGTCGAGTACGAGTCCGACAGTTGGCT
GTCAATGTTCAACCTCGGCATTCGAGTGCACTCGGTCTTTCCAGTCGCCTGGAACGGGTTCCAACCGCAGGAGCTCCAAGCCAGAAAACTCCACCTGGTC
GACATTTTTCAGCTCATCATGGACCGTCTGCTCACGACATCAACGGAAATGAATGCGTCTGTGGCGAAGAAGACGTTGGCGCCGATTACGGCGCTTGTGA
AGGCCAAGAAGGCGGACCTCGACGACGATGACGTGAACACAGTGAATGCGTACGGGTTCAATGTTGGCGCTGACCGAACATCTCTCCACATCCCGCTGCA
TCGCTTCTTGGCGGCTTCTGTGCGTCACATTTGTATCCACCAGTCCGGATTCGCAGACTTGATCACTACTGAAGGACTGCTGAGCGCGTTTGGCTTTGGT
AACCTCGCGCCCGAATCCCGTCTCGAGCTCGTGGAAATGCCTCTGCGCTGTCTGGTGATGGCGTCGCAGATCCACTCAAACCTGTGGCGTCGCAACGGCG
ACGAGAACATGCTCGCGCAGTTGTACAACTACTCTGCGTTACCGTACTGCATCCACTACCGCGACTCGGATGTGTTTATGCTGCAGCTTGGTGTGCTTCT
GCTGGGGCCCGACACGATCCTGGCACTGATGCTGAACCAGTTCCAGCTTGGCGGATACTTTGTTCGTCCGACGACAGAGAAGCCCGATAGCAGTGGCTCG
TCATTCCCTACCAACGAGTTCAGCATTGCGTGGCAGCTAGGCTACTTGCGTCTCGAAGAAGGTATCGACCTCCCGCAAATGCTGCTGATGGTGGAGGAGT
TCTTGCGTCTGATCATCATCGTTGGAACAAGTCTGCCGAGCTCAACTGGCGTCGCGTACGAGAACGAGTTCCTCGCTGAAGAGATGCTCCAGCAGCTGTG
CGCGAAGTCATCTTCGTTCAGCAAGCTCTTCGACCTCGCAATCTTGCCTTCAGGACAAGACGATTTGTCGATCACGCGTCTGGAAGGGATTTTGGAAACA
GTCTCGAACTTTGTGCCGCCATCGGGACTTGACGCTGGTCGCTACGAGCTCAAGGACAGATTCTTGGAGAAGTACAACCCGTACTTTTTGCACCTGAACC
GCGAATCCCACGAGCTGGCGCGAGACAAGTGGACGAGCTACCGGAAGATGTGCCTCCAGAAGAAGAAGACGAACAGCAAGGGCGCGAAGGACACGAGCGT
GCCTATTGAGCCCCTTCGCGCTGCTGCGACCCCGGTGCAGTTTCTGCGTCCCGTTCAGAACATCTTGGTGTGTGAGGGAACCATTGCGATCGTGCAAATG
ATTATGTGGAAGGTGCTCCGAGCCGATGGCGTCTCCTCGTCGTCAGCGAGCAGTGTGTCCAACACGGTGTCGGATGCCGTGATCTCCACGTGCCTCCATC
TGCTTGTGCACGGAGTCCACACTGCGATTTTATCCGCTTCGGAACGCGACGGGTTCTTCTCTCGACTCTGTGTGGTGAACTCGAATCTGGACGACTCGTC
GGTGCTGCACTTGCTGAGCAAAGTCCACAAGAAACGTGCGACGATCCTCGACGAAGAGCAGGCTGGAACAATTGAGTGGCTCGTGTGGAAGATCAAGGAG
GTGTCGCCGGCGTGTCGAGACTTCATGACTGCGCTCGAAGCTGAGGCCACACGAGGCACTGCGAGAGCACGAGCAGCGGGTGGAGGCAAGGCGTCAACTG
CGGCCGCTCCAATTACACTAGAGCAGCGCAAAGACGAAGCCCGTAATCGAGCGCTGGCAGCGATGGCGAAACAGCAGGCGGCTTTCCAGGCGATGATGGG
CGAGATGGACGACGACGACGGCGAGAGCGAGGAGAAGGAATCAGAAAGCATCCGCATGGAGAGCGCATCTGATGATGAAGACGAGTCCGCGGATGTTGTC
CTGCTGGGTAAGCGTCGCGCATCGATCCAAGAGACGGACGAAGAGCTCAAGAAGCGACAGAGAATTGAAGAAGACTCGTGTCACAAGTGCATCTTGTGCC
ATGACACGTCCACCCAGGGCGAGATGGGCATGACGGCGTACGTTCACCAGTCGACTGTGCTCGCGACTGCGTTCCGTCCGGAAGCCCACGAAGCGCTTCG
ACCCGAGGGCAAGAAGGTTCGGGCTCAGGTCAAGGCACTCATTGAGAAGATGGAGCTCTGTTCGGGTGGACCAAACGGTTCGTCGTACAGCGACATGTCT
CCTTCGCCACCAATGCGAGGTTATAACGCTCCTTTCCCAGATTGGTACATGGACGACCCGCTCGGGTTGGAATCTCCGATCCCGCAGCTGAGTCCAGGAC
AGAGACGTCCGCGCCGAGAGCAACCTCGATTTCCGGCTGCTCCCATGCCGATGCTGGAAGGCGAGATGCTGCAGACTGATGAGGAGCTGGAGGTGCTGGA
AGGAGTGCTGAACCTGCGCGAAGACCAGCAGCTCTTTCCGATGGATATGCGGAGAGCGATCAACTTGGAACTTCGAGGTGCTCGTGCTGCACAGCAAGCT
CGTGGACGCGACCGAACACCACCCGCTGAAGGCCGTCGCCACCACACCCTTGGGCACCACCACCTCCACCACCACCACCACCATCACCACGGGTTCTCAG
ACGACAGTGAAGACGAAGGAGAGGAGTTCTCCCCAGGCTTCCACGCCGACTTCTCGCCGCCAGGGATTAGCAGTGCGAACCGCGAGAGCGCCAAGCTCTT
CCTCACCCCATGCGGTCTTCACATCCGAACCTGTCAACATGCGGTGCACATCCACTGCTTAGAGCGCTACATCAGCTCGTTGCACGACAAGGCGATCCGT
GGTGAAGAGTTTGACGGCGTGCAGGCGATCGACCCGGACTCGGCGATGACGCAGTTCCTCTGTCCATTATGCAAAACGCTGTGCAACTTTCTAATCCCAA
CGTCTGATCCATCGCTGGCGGATGGTGCTGGTGAAGACGAAGTGATGCTGCTTGAGGGCGACATCACACCAGAAGAGCAGCGGAAGGTGGCGTCTTGGCA
CAGCATTGTCGAAGAGCAGATGCGCGTCTCGGGCTGGTACCGTGTTGTGCTCGGCCGTAATGGGGATTTTAGTGAAGAGAACGACAGCGTGCACGACCTG
TGGCGGGATTACTTTGAGGAGACGCTCTGGGAGCCACACGGCAGTCTTGAGAAGGGCGCCCCGTTCCTGTGGTCAGCCTGTGCATTCTCAATCGCAGCGT
TCCTCACTGTCGCAGAAGACGAGCACCGCACTGTCTATGGCAAGGACGCGATGTACGATCCGCTAACCGACCGGTGTCCGCCGGCGATGGAGAAAGAGCT
CGCGTCGCTCGCGGCCGTGACCAAGTTCTGCCGCTGGTCGTTCTCGCTACTGGAGCATAGTGCGGACGCTAAGGTGATCTGGGAGACGTCGAAGCGATGC
TGTCCGATCAACAGCGAGACGAAGCGCGAGTACCGCAAGTTCACAAAGGTATGATTGTCTTGCTCTGGTGCTGAGCTATCATGACTGTGCTTCTTTATCT
GACTCGGATGCTGTGTGTGTTTTTAGCTGCTTGGCTCGATCGACGCGTGCTTGCGAGGCACGATCCTTGGTCTGCTGGTCGCAGACACGTTCACGGTATG
GATTTTCTTGTGTGTGTATTTATTGCCAGCGTCCTCTAACAATGTTGCGTTCGCACTGTGTGTCTATATACTCACAGGCATTCATTGTGTCGAGCGTCAT
TGCGATCGACCCGCTGACCATCTGGAGGTTCATCCCCGTGTTCAGCGTCGCCGATGTGCTCCAGCGGCTCTACGCGGAATTCTTTGTCGTTGAGAACACT
GAGGACACATCGCTTATCCAGGACAAGTTCTCTCTTCAGGATATTAAGAGCATCGAGCAGGAGACCAAGGAGGACGGGCTCGCCATGTCGCTGTCGTCGT
CTGTCAGCCGTACGCGTAGCGGCAAGGCGATCTCTGGTGGTGAATCTCGATCGAGAGCTGGATCGGTTTCTTCGAACTCGCAAGACTCGCCTGCACTCAT
CGTGCAAGAACTAATGGAAGCGCTTCTCGTGGACGGACAACAGCACGACGAGGAGCTTGCGGTGCTCACTCTGCTGAAGCGCATGATCGCTGCGGACTCG
AGCGAACGCCTCAAGCCTATTTCACGCAGCGAGCTGAGTGGACGTATTCAGCGTGTGAAGACTGCGAATGCCATGTTTGTGCGCCGCATGAAGCTCTTCT
GGCGCTGCGTAGCGGACCAGGAGCCATTTGCGACACGCTACGGCACGCTGCAGATCCCGAGCATCACGGAGATCGCGCAGACGTCGGACGCCGTGCTCGA
CCAGGTGTGGAAGTGGTGCGTGGACCGTCTGAACAGCAAGAACTATCTGGGCGTGGGCGCCAAGAGCGGCGATAAGTGCGAGCACACGGAGGGCGCGAGC
GAGGCGTACGTGGCGAGCATGTTCATTCTGCATGACGCGACGTCCAAGCCGCGGCTAATCGACCTGCCTGTGCAGTACGACGAGCTCTACAGCCAGATGA
CGGGCGTCAAGTGCGACCGGTGCGAGAAGACGCCGTGCGACCCAGGCCTGTGTCTGCTTTGCGGCGAGTACCTTTGCTGCGGTGACGCGTGCTGCACGCG
GCCGTTTATCACGCACGGGCCACAGGTGGGCGAGTGCACGCGCCACGCGGCTGAGTGTGGCGGCGGCATTGGCATTGTCCTGATGCTGGATCAGTGCCGT
ATCGCGATCATCGGCGGGAGCATGGCAGCGTACTTCCCGAGTCCGTACGTGGACGCGCACGGCGAGGAGGACGTGGGACTGCAACGCGGTCGGCCGCTGC
GCCTCGACGCGGCGCGCTACAAGTACCTCGAGTCGCTCTGGACTAACCACCGGATCTTCACCGAGGTCTCGCGCCAGCGCAACCAGCGCGAGCCGCAGTA
TACGGTCAACCTGTCGTACCTGTAAACCGGTTGAAGACGATGGAAGACTGGGTGCGAGCACCTTGATGGGCTCCAAGTAGGAGAAGAAGAAGATAACAAA
GTAGATCTGTGAAAGTATACATATTGCCTACCTCTGTGTGTCTTGTGTGTGTTTGTCGGAAGGTTTCCAGCAGCAGGCCACCCAGGTCTAGGACTAAATG
TGAGTTCAAAGCTCAGCCCAGGAACGTGAGGTGCGCCGGTAGCTCGGCGTCGGCGTAGAGCTCGTCCTGGAAGAAGACGCGCAGCAGGCGACAGTTGCCA
CCAATGCGCACGCGGGTCGTCGTCACGTGCTTGGTGCCGAACGCCTGGCGCGTCAGTTGCTGCAGGTCCATGCAGAGGTACCGCCAGCCAGATCCACTCC
CGAACGCCAGCGGTAGCTGCACATTCGTGTCCTCCACACGTGCGAGCGATTTGGCGTTCGTGACCTTGAGCTGGCGATACGTCTGCTTGTCGTCGAGCAC
CTCGAGCGAGAACTCAAAGAACGCGTCCAGGTTCTTCACGAAGAGCACCAGGTACCGAAAGATGTTGTGTGTGCGGAAGAGCAGCTCGGCCTCGGTCCCA
AGCACCTCAACGACCTCCTCCTTGACGTCCGCGTCCTCGACGACGGACACGGCGTTGCCGTTGAGCAGACTGTCGCACTCCTGCTGGGCCTGCTGGATCA
CAAAGTACTCGCTGAAGGGAACCACGTGCACGTCATTGTCGCTCTCGTCGTGGTTGCCTCGAAGACTGGTGCTGTTGATGGAGCCAACTGAGGATGGCGA
CTGCTTGCTGCTGTTGCTGTTGGTGTACTTGTGTTTTGACAAACTCTGCTCGGTGCTCGATAAAGGCGAATGGCGATTCGTCGTGATCACTTTCGGCAGC
AGACACTCCAAGTAGACGTCTCCGGGTGAGTACGAAACCTCACCGATGTGCACGAACGAAGAGGACGAGAGCGATGTTGAGAGCGCCGACATGGGCGACG
ACGGGCTCTTCATGTTGCCTGTGGCCTTCAGAGACTCAATCAGGTTCTTTGCGCTTGACGGACTCCTTTTTGGTGACGGCTTCCTGTGAACAGGCGGTAG
TATAAATATCAGAGTACGGCCAGCTACAGTCGACGAAGAACTGGAGATGGCTGCACCAGAGAACTCCAACCTGTCGTCGTCGTTCTTCCACACGTACAAG
GAGCTCTTCGAGTACGAGAGACATGTTGGCAGCGAAGATCCCGTGGTGCTGAGCCAGAGAGACTGCGGTGGCGTTGGAACCAAGTCGTTCCTTGACAAGT
ACAAGGAGTGTGAGCAGCGCCAGGTGATCGAGTCGCGAGCTGCTCTCCAGCTCCCACTCACGCCGACGCTGATGGTCGACACGAGGGCTCAGCTCGGTCC
CATGATCATGCCTTTTGTCTCGTCTTCGACAACGTTGAAGCAGCAGTCGGAAATAAGTCACCAGCAGACAATTCCTCTACAGCAAGTGTCTCCATCGTTC
ACGCGCTCGAAGCTTGAAAAAAGTCTTCGCCAGTCCCTGAGCAATCAAGAGGAAATAGCGCCGCCTTGGTCAATCGCCCCGTACTATCAGAACGCTGCAC
AAGTTCCAGAAAAGCAAGCATCACCAACCAAAATCGTCGTACCTTCAGTGCCAGCGACCCTGCCAGTCAACGCCACAAAGTCACACACTCACACTCTTCA
CGCCGACCAATCTTCACCACAGTTTCAACCACCAAAGCTCGCTGAGCTGCTCATTGACAGCTCCACTCGGCCCGCGACGCTGCGCCACAGACATTTGGAC
GAGACCAAGAAGATCGAGCAGCTCATCGGCAACAGCTGCGGCGGGCGGATCAGCTCCGTGTCAACGAACCTGCCGCCTTCGATCCGCAGACGACTCCAGG
CTTCCACGAGGGTCGAGCAGCGTCGCGAGCAGCTCTACGCGGTCTTGCAACAGGAATACCACTCTCTATGTCATCAGCAGTAGCCAGTCAGTCAGCACCT
CTCTCGGCCTTCCTGTCAGGCTTCGTACGACCAAGGTCTGCCGTTAAATTACATCTTTTGTCTCCTCTTCTCTGTTTACATCTCCAGGAGGAACGCATCC
TCGGGGAAGCCGTCAAAGAGATTGCTGTTGATGGCGTCGTCGAAGAGCGAGGAGCTCTCGGAGAACGCGCTCGACTGTGGATCTGGTTCTTGCTGTTGAG
GTGGTTGCTGCAGCTGAGTCTGTTGTTGCTCGGGCATTGTTGTAAACAGAGGCTGAGCTGTGGTAGTTGCTGTGTTCTGGAACTGCATACTCGAGTTCTG
TTGAAGTTGTTGCTGCTGCTGAAGCTGTTGTTGTTGTTGAGGCATACTCATCCCAAACGGAAACGCGTTCATCATCATCTGCTCGGGCATCATCGGGAAT
GTACTCATCGGGTTCATCATCGCCGCCGACTGCATGCCTGGCATCGTATCAAAGCCGCCAGTGACGGGGTTGAACTGCGGTTGGCTCGCGAACGCCTGCT
GCTGGTTGAACAGCGTGTTGAACGGGTCCGCTGGCAGCTGGTTCGAGCCCATGCTGCCGCCGTAGCCGTTGAACATTGCCGACGGGTTGTACATGGCACC
ACCGCCCGCTGCCGCCATATTCATCGGCATCTGGCTCTGTAATTGCATCTGCATCGCGAGGTACTGCGGGTTCATCATCGCCATGGGGTTCATCATGTAG
TTCTGCTGGTTCATGAACGCCATCGCTGCTGGATCGCCCGTGTTCATGTATGAATTGGTCGTGAACGATTGCGGACCACTCATCGTGAACGCCTGCGCGG
ATGCCGCGGTCATCGAGGTGTCGCTGAAGCCCGTCGAAGTCATCGCCGAACTCTGGTTTGAGCCGTAGAACACACCATTCGTTGTTGTCGGATAGCCTGA
GAGGTTATATAGCAAGCCCGACAAGGTTAGCACCTGCAGATAACAGTGTGCACCATCCACACAGCTGGCGAAATATGCACGAACCGAATTGCTGAGGGTT
CGCCATGGGCATGGGCGGCTCTGGGAAGGATGTCGGCGATGGGATCAGCGCAGCCGCTGTAGGTAGCTGCATGCTGCTGTTGTCTATTGTTGCAGGAGCG
ACATGCGCAGCTGGTGTCGCCTTCTGCTTATTCTGCGCAGCTTGCTGTGCAAGCGCGATCGACGCTTTGGACTTTTTCGATGCGGTCTGGGGCACGGCAT
TCGGCGGCGCCACTGCCACCGGCGCTTGCTCCTGCTGCGTCTTGGCCTTCTTGACGCGGTCCGAGCTCTCGTCTTCGATCGCGATCTGCTTGTCCGCGAG
CGACGCCAGCACCTCAAGACGCGCGCCGACCTGCTGTCTGTACGTCATGCACTTGCGGATCCAGTCCTTGTGCTCTCTTGCCAGTGTCTTTGGCGCTATA
CACACACATAAACACGTTCATAAGACACCATACGAATAGTTGTCGCATGATACAAACACGTACGCTCTTGTGTGTGCAACACGTTCCAGCCGCGCAGCGT
CGCGTCGTTCTTCTCAAGCATCGCCTGGATCTCGCGCGACGAGACCTTGCGCTCCGCCGACAGAAACTACACATACACATTCATACACACCATGAGTCTA
TCCATCAATCCATATCCACAGTTCCAATAGCTCCAAAAGAGCTATTCAGAAAACAATTCATTACCTGGGCCGCCACGGCCGCGCGCTGCTGCAGCTGCGT
CGCACTGTTCGTCGCTGCAACTGCCATCTGCTGCTGGTTGGAGCTGCTACTGCTATTAATGCTGGTGCTGGTCGCGGAGCGCATCTGCTGCTGCTGCTGC
TGCGGAGTGGGGAACGCGCCGTTGGCCATCGCGAGACGCGAGTGTTTTCTAATATGAATGCAGAGTTAACACGCCCATTTCTTCATTTTTGAATCGCGGG
GCGAAAAAACGCCAAATTTTAGGTGGTACACGTAGTATTAGGTGTAAATACGCCTCGTTTTACGTGTATCACGTAAAATTAGGGTGTTTAGAGCCGTAAG
TAAGGTGGAAAACGTTATGCTTGCACAAAGTGTTTTGCCTTTCTTGTGCAATTGACAGTCGAAAAATGAAGATGGAGGAGGTCGAGAATGGGAGCGCGGG
CGTGTGCGTGTCGGCGCCCGGCAAGGTGCTGATCACGGGCGGGTACCTGGTGCTGGACCCCAAGTATGCGGGCCTCGTGCTCGCGAGCACCGCGCGGTTC
TACGCGCGCGCGTCTCCAAAAGCCCAGGTGTGTGTGTGTGTGTCATCCGCTCCATTGCGAAAACCAATCTTTGGCCATCTCACCATTCCTGTTTATGCTG
GGCGTGTCCAGAAGGCATACAATGGAGAAGATGCAGCGGATACAATCCGCGTGGACATTGAGAGTCCGCAGTTCAACCAAGTGGTCCGTGGCGTGCTGCG
TCGCGGTGCTGGAGATGCGTACCAGTTCCTCGTGAGGTGAGCAAGCAGCATGCTTGACGTCCAGATCACCATAATCTTTGCATTGATCTGACAGTTCATG
TGTATGCATATGTCCACAGTGATGGCTCGGACCGCAACGCGTACATTGAGGAGACGCTGCTGTGCGCGATCAACGGCATCGAGGGCGTCGCGCCGGCCAG
CGTCGCTCGCAAAGCCCAGGAGCTACGAGGAGCGCAGGAGCAGCTCCGCGTGCTGCTTCAAGCAGATAACGACTTCTACTCGCAAGTGAAAAGAGTGAGT
AAGCTGTTGTACGAGTTGTGTTTGTGTGATTGGTAACGCTAGAGCTTAAGTGTGCGTATCTGTTCTGCTTTGTGGTAGTTTCAGAGCTCCAGCAATAGTC
TGCACCGACGCAATATCGCAGCGCTCCAGAAATGTCTTCCTCCATACATGGAAGGTACGCTGACTGGGGATATGTTTGCTACATGGCGTGTGTTTAACGC
TCACTGTGCCCATATAGAGAAGCCAAATGGGGAGCGAGTCGCGATGAAGACTGGCATGGGCAGCTCGGCGGCGCTCGTGACGTCCTTCGTTGGCGCACTC
GTGTGTTTCTTTCTACCCGATAATCGCTTTGAAGAGCGCGACGCCGACCTCGAGCTCATTCACAACCTCGCGCAGCTGAGTCACTGCTTTGTGCAGCGCA
AGGTGCGATGATTCCCCATTTGTTTCCTACGTTTCCCCCACAATGTGAGACTCGAAACTAATCTCACCACTCTTCTGTTGTTGTTTTTTTTGCAGATCGG
CAGTGGCTTTGACGTGTCGACTGCGTGCTTTGGTTCGCAGCGGTACACACGCTTCCCAGCATCAATTCTGGGCGCGTTCACGACCCCAGAGGCGCTGCAG
CCAGCGGCTCTTCAACGAGCTCTGCTCGACCGCAGCGCGTGGGATGTGGCAAATCGCGTTGTACGTCAACCTGATCTGATACGTTCAATGTTTGTTGCGA
AGCGCCTAACTCTGATGTACGATTCATGCAGAAACGGTTTAAGCTGCCACTAAGTCTCTGCCTATTCATGGGGGACGTGTCTGCTGGCTCGTCGACCGTG
TCAATGGTTCGCCAGGTACGCTGTTGCTTCAGTTTAGCCAGTGGCTGATGAGATTATTTCAGTACCAATCCCCCAGCAGCATTGACGATGATAACATTTG
TTACCATTCGTGCTCACAGGTGCTGAGTTGGCAGAAAGCCCAGTCAGCAGAAGCAGAGCGTATCACCTCACGTCTGAATCTCCGCAATTCCCACGTTGAA
GCTGGTTTCACCAAGCTGTTGGCGCTGTTTGAGTCGCCTCAACACGACACATCCAGTTTCGAGAAAGCCCGGAGGGAGATGGCGCAATGCACTTTCGACC
AGGTAAGCGTTGCTATTGCGTGAATGCAAAATGGTCGGTACTGAAAATAAGACTCGCTAACCTGGTATGTTGTTTGTCTCAATGCAGTGGCAAAGGGTCG
ACCCAGTGCTCGGACGTATCCTGAGCACCATTCGGGAAGAGTTCTTTGCTGTGCGCACCTTGCTGCGGTAAGTTGGTGACTCTGAATCACATTGTTAATG
TTCTTGTTCTGGATACTTAACTTGACGTGTTGTGGGACACAGTGAAATGGGGGACCTCGCGGGTGTTCCGGTCGAACCTGCTGAGCAGACGGCGTTGGTG
GACGCGACCATGGCGATCCCTGGCGTGCTCATCGCAGGCGTGCCAGGAGGTGCGTGCATTATCATGGGTATCTAGGGATGTTTTGGGGCTGCACCTGATA
ACTAGACGCTGTTGTTGGTATACTGTGTGTAGCTGGTGGATTCGATGCAGTCTTTGTTGTGGCGCTGGACGAGAGTGTGCTGAACCGTGTCGAAGAGCTC
TGGGTGCAGTGGCCACAAACCCACCCGACATCCATGTACGTGGTTTTGTATCCATGTGTTTGTTGCGCTGATGGTTGGATGATGATACTAATGCTGTGCT
TATGCGTTTATAGCATATGCCCCCTGCTGTGTGATGCAGATTCAGGACGTGGGTTG