Description :
From Genome Similarity Track
Location :
Scaffold_216:5982- 7282
Transcript NameFunction/comments
Phypl_g5415hypothetical protein

Sequence
1300 bases(100 bases per row)
ATCGACAACGCCGATGTAGGTGATCCAGGAGACAGCACCCCTTCCCAGGAATGCAAGCTCAAGGGAATTCTGAAGTACCACCGGGCTATATTCCTTGGTG
ATAGGAatgcagctcctgcgccagctcgcggtGTGGTGTGGGATTTGGACGTCGGTGACGCTAGGCCTGTGGCTCCGCGTCCTCGATCTATCGCCCCACA
CCTGATGATCAAGGTGTATgagttgctgaagaagcttcTGGAGACCGGACTGGTCGAACACTCCGAATCTCCGTGGGCTTCGCCAATTGTGATTgtcctc
aagaagaacggcaaggATATCAGGATGTACATCGATTATCGCGTTGTGAAGGGCTTCATTCAGCTTTCCAACTACCCACTTCCCCTAATTGATGACCTGC
TGATCGGCTTCGAGCGAGCTATATGGTTCATGAGCCTAGACATGGCCAGTGGATTTTGGGCAGTCCGGATGACAAAGAGAGCCAAGATGATCTCGGCATT
TGTCTGTCCATTCGGACACTTCCACTGGGTTCAAATGCCATTTGGGATGAAGAACACGCCACTGATCTACCAGCACGTGATCAACAACTGTTGGTGGGGT
TTCGTTTGATTGCCTCctgaggaagaagctcttgTGGACCAAAACGTTCTGGACTACCTGAAGTTGGATCCCTACGAGCCACGACATCTGGGTGGTTCGG
AGGAAGTACATTCGGGACAGCGTCTATCAGTGCTGACAGAGCAAATGACGGCCTTCAAGCGGAACATCCCAGCTCAACCTCAAATGGGTCCTGTCCTAGG
TCGTAGTTCCTACATCGATGATATCGCGTATGGAGCAGCGACCTGGGACCAGCTGTGTGATGACTTGGACGCGCTGCTTTTCAGGCTGTGTTACTGGGAT
ATCTCGGTGAGCTTGCCCAAGAATGAGTTCGGGAAGCGAATTATCCCATATCTATCCCATGAAATAGGTGCCGAAGGAATTCGAGCTACTCCGAAGATCG
CCAAAGGGATCCAGGAGCTACCGTTCCCATCCACCCTGAAGGGAGTCCAGTCGTTCTTGGGCAGCCTCAATTACTACCACAAGTTTATCGAGGATTTCCG
TGTGGTTGCCGCAGTCCTGTATGAACTGACAGACGAACAAGTTCGGGTCGGTAGGGACCTAACTCGGGCGAATGAAGCCTAAAAAAGAAGACTGTTTCCA
CTCCGATGCTTCGACACCCAGATCGAACCAAGCCGTTTGTGGTCATACCACATGCTAACCAGTGGGCAGCTTGCGCTGTTCTTGGGCAGGAACATGATAG