Description :
From Genome Similarity Track
Location :
Scaffold_2065:598- 2008
Sequence
1410 bases(100 bases per row)
CTGCGAGACCGGCAAAGGACGACCCACGATCAGGGGCGAGTCGCCGGGAAACATCCAGGCGACATACCCGTTCCAGATCATAGCGATGGATCACATACAT
TCGCTACCCAAGTCGTACAAGGGTAATACGGAACTGTTGATCTGGGTCAATCTGTTCACGGGATACGTGATCGCGAAGGCCAGTTCCTCCCGAACGGCGC
AGACGATCGCCGAATCTTACGAAGAGTGTGTGTTCCGGCGATTTGGTGCTAGCGAGGTGATCAGGCACGATCGAGAGCCGGGAGTTATGGCTGACTTCTT
CCGCGCCTTTAACAAGATCCTGGGTATGTACCAGCGAGCGACGATGGCATATCGACCTCAGGCTAACGGTACTGCAGAGCGAATGGTACAGACGGCGACG
AGGGCCCTGAAGATGTTCGTGGAGGATCTGGATCAGAGGGAATGGGATGAGTACGCAGAGCGATTGACCTTCGCGATCAACACGGCTCAGGATCGGGTCC
GTGGGGACCCCCCTTTTTATATGGTGCATGGATGGGATCCTCGATCGACGCTCGAGGCAACGATACCTTTGGGTAGTACCCGGACTCGGGATCGGGATCC
TCGACGGTGGCGTTATCGGATCCAGAAGCACTACGATCAGGCTCGGAGTCAGGTGAATGATCGACTACGCGAAGCGATCGCGGATCGGGCCGATCGACAC
AATGAAGAAGTTCGACCGCACTCGATCGAAGCTGGATCTCAGGTGTGGCTGTACCTGGATCGAGTGAAAGAGGGCTATGCCCGGAAGTTGGCCCACCTGT
GACGATGGAATGGATCAATCTGAGTACTTCGTGCTACGCGTATGGAAGATCAGCCTCCGCGTCACTTCTATTCTTGGGGTATGGTCGACTGGCTCGCTAT
TCGCGGAAGTCGATCGTGGAGACGGCGATCATGTCACGGCTGGTGTTGGGCGCTGACGTTGGGGTTGAACTTGTTGCGGAGACGCGGGATCCGCTGGGCT
GGATGGTCCTGGGGGTGGGCGCGGTACTGGTTCCGCCAGGGATCATGGGTGTCGGCCTCGATCAGGGCCGTTCGGAGGTCAGTCGGTTCACCATGGTGTT
GGGTGGGGTTGCCGATGTTCGCAGCGCGAGATACCACGCCAGGATACCAGGTTACAGCGTCCCGCTGTCGCACCGGGATCTGCAGGAAGAATGGGTCCAG
CAGCAGATCGACGTCTGCCCACATCTCTCGCATCATCGGCAGCATATCGACGAGGAGTCGGCGCCACCGATCACCGAGGCGGATCCGTCGGGCACGACGA
TCGCGATGGTATCGCTTGACGATCTGATCCCGACGCTGGGCGCCCGTGATCGGGAGATAATGAGTTGTTTCCCAGAAAGCCTGGCGATTCTGCTCTTCGA
ACTGAAGATA