Description :
From Genome Similarity Track
Location :
contig_9:59798- 61676
Transcript NameFunction/comments
g2576.t1hypothetical protein
g2577.t1POM63999.1 Mannosyl-oligosaccharide alpha-1,2-mannosidase [Phytophthora palmivora var. palmivora

Sequence
1878 bases(100 bases per row)
GGTGTCGCCTCTACCGAAGCTGACGACGAAGAGCGGGCTTGGACGATTGCAGGAGGCCTTATCCGCAACAAAGCCCAAACGAAGGAGTGGCTGAATTCGT
TGCTTCAGAAGGGAACGTCCGTCGACGACGTGAAGGGCATCCTGGGTTTGAAGGGCTTATCGTTGGAAAGTATGATGAAGCACTGGAACTGGAATGCCTT
TGACAGATATTGGCGGTTGGTGCATGAGAAGGGCAACCGCAAAGAGATCCCGTACGCTGTTTTTGGATCGGGCGAGCAAACTAAGAAGAACACGCACGAG
GTGCTTCTGGGGTGGGTTCTTTCCGGAAAATCAGTGGAGGGGTCGGCAAATACCTGGGGGTGTGGGGATTGCCAAGAGCGAGCAACTCCTCCATCAAAAC
TGGAGAGCGTTCAAAGCCTACCGTAAAATGTTCGTTCAATACGAGACGGGGTTGCAGAAAATAAAGGACCAAACGCAGTTCGCGTATTTCGACAAGAGTT
TTCGAGGCATTGACGAGGCGAAGGAGACGATAACGAAGTGGGCCATGAAGGGGTACTCAATCGATTACATCGCCACGACGCTGGGCTTGTCGGGCTTGTC
GGGGGCCAAGCTGACGAGCCACATCAACTACCGCGCGCTTGGTCTGTACAAGAACGACTTTTACGCCTTGGCATCACTGAGAGAAGCTAATGCGAAAGCC
AGAGCCAAGGCCAAGGCACTAGCCAAAGCGAGAGCCGCTGCCGGAAACGCTTAACAATGATAAGTGAACATCGCCATTAGAACTTCTTTGAAAATGTATG
TTTCGTACATAAATGCTTCATACTGAAACCAAGTGGGTTGCCATTCTGAACCAAGTAGCATGGGGCGGCAGCCGCTGAAGGAGGGCGGCGGACGTAAGGA
GCGCAAGAATGTGCGCACGTCCACGACGTTCGAGACTCGACTGGCAGCGATCAAGCACTTCGAGGAGAGCGGCAACATGACGTCCACCGTGGATCGCTTC
TTCCCGGCGCTCACGCCGGAGGCCAAGCGCAACAAGAAGCGCGTCGTGTACGGCTGGATGAAGGACCGCGGCAAGATCGAGAAGGCCTGCGAGTCGGTGA
GCACCGCCAAGGCGCATCGCCTGCGCAAGCCAGGTCTGGGCCTCACGCTCAGCAATGACGCCGAGAAGTGCATCGTGGTGTGGCTGCGCTCACTGCTGAA
GCTGGGCGTGCCAGTGACAGGAGCCATGCTGTCCGAGCACGCGCTGGAGGTGGCCAAAGAGCTGGGTATTGACAACTCATTATTCACGGCCTCCGGCCCT
TGGAGGAAGAGCTTTCTCCGGAGGCACAATTTGGCCATGTAGATCGGGAATCGCCCTGACGAGCATGCAAGTGCCCACACGAGTGCATGAGAGGTTCTCC
TGTGTTAATTCCATGTATTTTTTAACCCCAATATATGCAGGAGGTACATACTGGGCGTTTGATGAGGTTGCTAGACCATACGTGGTGAAGAAATTCCTTT
CCGTGTACGCAGAGCTTAGCTTATCAACAGTTCAGCGCCAGCTCTGCTTCCTCCAACCGGTTGCGAAGTTACATCCATGTCGTCTTAATGAGGTAGTCCG
GCACCTCAGCCTCTTTACCGGTGAGCGTGCGCGCGCACAATTCACCCTCACCCTTTCATCTACGTGTAGCGATCAGTCGTTGCTTTTTTGCGGTCTCAAA
TGGCTACACATTTGGCTATTGTTGTAATAAATTCAAAGGGTCATCTTATCGGCTCAACACGTCACAGCAAACCTCAATGCTGCCGTCGTACTCGCCTAAA
GGCCGCAAGCGCTCGCAGCAGCTGCAGCTCTGGAAGCGTGTGGGGCTCATCGGCGTCGTCTGTATCCTGGTTCTGTTC