Description :
From Genome Similarity Track
Location :
Scaffold_162:5979- 10826
Sequence
4847 bases(100 bases per row)
ACGAGAAAAGAGGCAAGAGGCGGCTGACGACACTGTTTGTCCTAGCACATGGTTTCTCAAGGTATTTGAACGGCTACCAATCGATTGATTGGCAGGCAAG
CTCACCAGGTCAAGAAAAGGTTCAAGCATACAAGCGAGCGATGCTGTGCGACTGCAGGTAGGATAAACGTAATACAGAATCCTTTCCACCCTTGAGCCAA
TTCTTTTGAACAGGTTATGAGCTCAACTGAAAGCTCCAATACGGCACAGGAGCCACCAACTAATGGTCACGAGAGGGCTGTGGCGGAGCCTGAAGAGGTC
ATCAATCCGCCAGCTCACGAAAGGGGCGAGTACACGAACGAAAGGATCCTCAAGATGCTCATGGAACTTGAGGGTCGCATGATGGGCATGGAAGCGTCGC
AGCAGCAGATGGATGAGAACAAGCGGCTCCAAGGCGCGAATGAAAGTGGTCTTCTCAGCTCGCTGCTCGGGCGCAACATTTGCAACGCTGGACCGATGCA
CCTGGATGTGCTTGGAAATTTGCCGCCGAGGCGACAAGCTGCGTATTAAGCGCAGTGCCAACCAAGGCAGTGCCCGATAGTTTCACCGGCTCAAGAAGCA
CATGTTGAACCGCTCGGACCGCAGTACGCGGCGCCAGACTTGCGACAAGGCTTTCCAGGGCAGCAGTTTCCACATCAGATGCCCCAACCTAGGCCTTAAC
AAGACCAGCAAGCGACATTTCCTACGCATCGCGTGCCGGACGCGCGTCAACGGAAGCTGGCCATCAGGAAGTTTGACGGTAGCGAGCTATACCATAGACT
CAATTCCGGCTTTCTCGATTGGAACAGAACATTTTCTCTGGCAAGTTACGATGGCCCAGCATGCGTGCGGTTTTTGCCTGGTCCGAGGAAGTCAAAGCTG
ACTTACTTGGACACTACTTAAGCAAAACCGCAGAGCGCTATTACAACAAGCAGCTGGAGTTGTGGTGGACACAACTACCGACGCTAAATCATGTCATGGA
AAGGCTCCTTCAGACATTACGACAACGATCACGTCGTCGCAGTTAATCTAGCTCTTCACGACGCACAAAGACCCCAAGAGAAGCTGGCAGGAGCATTACC
TTTACTTGGTTGCCGTCAGCGACGCGTGTGGTGGCGCGGACCAACAGGTGCTGAATAATATCGTGCATTACGCATCAACGGAATTGAGCACAGTGCTTAT
GGCTAAGTACGACAACTTAAGGGTGGACCATTTGCGTTAAGCCGAGGAACTCACTCACTTCGTGCAGTCTGTAGAGCTTGAGTCGCGTAAGCGCCGTGCC
CTTGGACGAGATGTTGTTGCATCCGTCGACGAGGTCCCAACAAAGAGATATATGCGCACGTGTTTTGGGTGCGGAAAGGCCGGCCACATTAAAGCCAACT
GTCAAAGCAAAGACAGGAATAGTCACGGTGTTCGTCGTGGAAAGCGTGACGTGGACCTCGTTTTGGAGATCAATGATTGTGGACTCAAGAAGAAGAACCC
GCATCTTGCGTATGCTGTAAAATATGCAAAGGACGAGCATACAGAATGGATCTTGGACAGTGGTTCAAGTCGTCACCTTGTAAGGGATGGAGCCTGTTAC
TAGATGCACAAGACTGCAAGTACGAATGCAACATGGCGGATGGAGAGACGTTATCCCTGTCACGAGTGGGAAGCGTCCGCCTGTGCATGATGGCAGGCAG
CAAGGAGCGCATGGTCAAGCTCACGGATGTCTACCTTGCAACTCAACTGAAGCGCAACATCATGTCGTACGGGAAGCTTGAGCTCAAGTGTTTTGGATTT
ATTTACGATTGAGAAGCACGCGTGCTAGCCAAGAGAATCAACGGAGAAGTGGCGCTTGATTTAGCTATGGAGAACAACGTATTATACGTCCCGACCGTTG
GAATTCGCATGTGACAGGCACGCCTGCTGACGTCATCATGGCGATCGTGGCCGACAAAAACGGAGTGGCTGACTCATCGTCTGATATGCAACAAGGAACG
CTCACGCATTTCACCAGCGGCTTGGACACCTATCGTATGACACGGTGGAGAGAATGGCAAAGTATCCTGCGTCAGGGATACAGCTTACCGATCGGCGCAG
ACCCACGTGTCTGTCGTGTGCCGAAGGTAAGCAGACAGAGAAGAATCAATCTCAACAGGACACTGGAATGAATTTTTCAATAGACAGGATTGGTGGAGTT
ATTTGTTCGGACTTAAAAGAAACCATGACGCCGAAGGACAGGCATGGGAATAGATATATTGTTAACTTTATTGACCACAAGTCGAACTACTGCCGCTTGT
TTCTGGCACCAACGAAGGACCGGACTGCGAAGCAATTTGAACATTTTTTGTGTTTTTTAGAAACGTTTTAACTGCCGGATCCACGTGCTTCGAACGGATG
GTGGCGGTGGGTACCAGAACGTTGACCTGTTCTGCAAGAGTAACGGTGTCACGCGGCAAGTCTCAGAGGCGAGAAACCAAGCGTCGAATGGGAAGGCTGA
AAGGGTACATCGGACCGCACTGAACATGGCGCAGTCCATGATCTTTGCAAGCCTCCTTCCTCTAACATTTGGGGCGATGCCGTCGAATATGCAGCATTCA
TCTTGAATCTAGGTTCAACAAGCTCAAATTTGCGTCACGCGTCGCCATTGCAAGTGATCACGGGAGTCGCCCCCGATCTGCGCAACATAGTGGTTTTCGG
CTCAAGCTGCACAGTCTATCGCGATCCGCGTAAGAACTCGCTAGCTCAGCGAGCAGAAGTCGGCATTATCGTCGGGAGGAGCGACAAAACGAAAGGTATC
GAGTTTCTTTGCAAAAGGAAAGGGTCGTTATCGTTACGCAACATGTGAAAAATATTGCGACGCTTAGCGACGAGCAAAACAGCCATCTCCAGAGCGCGCT
TGAAGAAGGTGATCCAGCAGCGCCAGATGCAGATGCCAGAAAGGAGTCTGAAGTGGCGTCGAAGAATTTAAGCGCGAGCTCGGACAACATGACGCAGAGG
GACGTCAACTTTGCGTAGCGAACGACAAAATATGAAGTCATGGACCCGCTCGTCACATGGTACGTGTGACGCGTCGAAGCTTGCGCAGCAAGTCGTGGCA
CAGGAGGAGGCGGACAAGAACACCAGAATCGTTAACCACGTGTACAAGCGTGATCCGAAGAACTACGGAGAAGCAATGAGAAGCCCGAAAATGGAGGAGT
GGAAGTTCGCAATGCGCGAAGAATTGGCTGCGTTGGAGAAGAATGACGTAGACGTTAGGGGGAGCAATGTATTACACACAAAGTGGGTGTATAAGACAAA
GGCTACTGCTGACGGAGACGTCGAACGCCTAAAAGCGAGGCTTGTGGCATGCGATGATGAACAAGCTTTCGGGAATGATTATGTTTGCTGCCGTGATGGA
TATGTCGACGGTAAAAATCATTTTGGCTTTAGCGGCAACATGGGAAGTTGGAGCGAAGCATGGTGACATCCCTAACGCCTACGTTAAGGCTGATAAAGAG
GCCGACCTGTAAGTTATCCTACAAAGTCCCAAACGAAATGGATGTGAGCAGTAAAACTGTCAAGTAGTTGGAAGCAGCGAGTGTGGATGGGATTGCGCTG
CAACTTCGCAAAAGCTTGTATGGCCTCAAGCAGGCAGGGCGGCTGTGAAGCCAGTTGCTTCATGATCGCCTTCTTGATGTTGGTTTCCGACAGTGAGTTT
CCGATATGTGCCTTATTGGAAGAAGGACGGAAAAGACCTTGTAATTGTCGGGGTCTACGTGGATGATCTTCTCGTAACTGGTACGGACACGGCTGACGTC
GATCGTTTCTTCGCGGGTCTTGGCAGCTTGGCAATCAATGACTTAGGAGCTGTACACAAGTTTTTGGGAATGCAGGTGATTATGGAAGACGATGGAAGCT
ACTTAATTGACCAAGAAACTGCTATTAGAGACATCCTGAGAGAGCATGTTTGGAAGATGCAAACTGGATGCGTACTCCTATTGGTGCGGATTGCTACGAG
GTCCCAACAACAGCCAGCGCGCTGCTAAAGGATGAAGACGGTGGAGCTCCGAGCATTCGTAATTTTCAGTCGCTCTTAGGAAGTCTGTTGTGGGTGTCGC
GCTGTACGCGCCCAGAAATTGCGTTTGTTGTTTACAAGGCGACGCGCCAAACGCACCAACCGCGAGTTCACGATTACAAACTCGCCAAGCAAATTGCACG
ATACCTGAAGGTTACTTGCGAATTCAAGCTACGCATGACACCGGCGAAGAGTGTGCAAGATAAAGTGACGTTAGATTCTTATTCGGATGCGGAATTCGCG
TCCGACAAGATGGACCGGAAGCCGCTGACCGGTGGGGTTATTTTGCTAAATGGAATGGCAGTGAGCTAGACGGCCAAGAAACAGGGCGGCGTATCACTCT
CCACCATGAAAGCTGAATCTGTTGTAGCGTCAGAGCAGATGCGTGAGTTGCTAGGGATCCGCGAGCTGTTGGCAGAAATTGGGGTGGCGCCCAAGCTGCA
ATGATTTTTCACGTCGACAATCAAGCCTCCATAAAGCAGCTTGATGGCGAGACTTCGTTGCTATAAGCGAAGCATATTGACGTGCGTCTCAAGTTTGTTC
TTGATTTCTCACAACGTGAGATCTCGGCGCAGTATGTGAGATCTGAAGCACAGATTGTCGACCTAATGACGAAGGCTTTGGATGCGGTCAAGCTTTCGTC
GATGTGCAAGTTGATGAGCCTTGGGTAGAGGCAGGACTCAAGAAAGACAGAAGGAATTACGGTGGTGCCGCAGCCGAGAAGGTATTTGCGCTGGACGAGA
AAAGAGGCAAGAGGCGGCTGACGACACTGTTTGTCCTAGCACATGGT