Description :
From Genome Similarity Track
Location :
Scaffold_194:5979- 7781
Transcript NameFunction/comments
Phymu_g6477hypothetical protein PHYSODRAFT_492233

Sequence
1802 bases(100 bases per row)
TGTGGTTCCGACGTGACCTGCGGCTGCACGACAACCTGGCGCTGGCtgaagctttggagctggtcaaacaagaaaaggagaagctggcacACAGTACAGG
TCGCAGAGTAGTGTTCATCCCGCTCTACATCGTGCACCGCCCCAAGATCAtgctctgcagcgtcaacCGCTTCCAGTTCATGCTCGAGAGCGTGTCCGAC
CTGGCTGACGCCTTGGCAGCTAGAGGCTCGCGGCTTGTGGTAGCCAGAGGCGACGGAGTGCAGGTTTTGCGTCGACTACTGCCGGCGTGGCGCATCACGC
ACCTGTTCTTCGACGCGGCCAGTGAGCCATTCGCTATCGCCCGAGACAACCGCGCAGTGGCATTGGCGACGCGACTGGGCGTCCAGACGCACGTGACGCA
CGGGTACACGCTCTACGACCTGGACGCCGTCATTACTGGGAACGAGGGAGAGCCGCCCAAGACGTACACAGCCTTCCTCCGGTCACTGTCCAtgcagccg
aagccgccCAAGCCACTTCCCACGCCGGAACAGGTCCCTGCATCTGTGTATTTGCCCAGTGAGCTCTATCAACAAGTGGTGGATTACTGGAAGAAGCGTC
TGAAACCCGATCCAGTGATGTCACAGTCTGAtgtgaaggaggagaagaccgaAGCGGAGGAAattgagcaagaagaacaagatgACGATCCTAAGGAAAA
GGCGAAGCAGCTTGGCGAGATTGGTGGCCCGGAGCAGCAGTTCACACTCCCTGAAGTGACGGACTTTGACTATGAAGCGCCTGAACGACACCCGTTCATC
TACGGTGGCGAGCAAATTGCGCTCAGTATCCTGCGTGACTACTGCCGCAATGAAGGCCGCGTAGTCAAGTTCGAGAAACCGAAGACCTCCCCGGCTCAAA
CGACGCCATCGGCCTCGACGACGTCGCTCAGTCCGTACTTGTACTTTGGCTGTATCAGTCCGCGGACATTTTTGCATCACGTGCGAGGCATTCAAGAGCA
CCACGCTAAGGCACTCTCAGCTACACCAGTGAGTCTGGATGGCCAGCTTCTTTGGCGCGAGTTTTTCCATTGCCACGGCCGAGCCAACCCGTACTTcgac
aagatggaggagagCCCCACGTGTCTGCAGATTGACTGGCGATGGCACACAATTCcagagaaagaggaagataTGACCGATGACGATAAGCTCGCTCGCT
CGCAGTTCAAGGCTTGGACGGATGGCCAGACCGGTTTCCCATGGATCGACGCGATCATGATTCAGCTAAAGGAGGAAGGATGGATGCATCATCTGGCGCG
CCACTCAGTGGCCTGCTTCCTTACTCGTGGTGATCTGTACATCTCGTGGGTGCGAGGCCTTGAGGTGTTTCAGGAACGGCTGATCGACCACGACTGGAGT
ATCAACGCGGGCAATTGGCTTTGGCTTAGCAGTAGCTACTTCTTTTCGGCTTACTTCCGGGTCTATTCGCCATCGACATTTGGCAAGAAATGGGACCCCG
AAGGTTTATTTATCCGCAAGTACGTTCCAGCGCTGAGCAAGATGCCAGTCAAGTATATCTACGAGCCCTGGAAGGCGCCGATGACTGTGCAGCACGCTGC
GGGCTGCCTGATCGGCAAAGACTATCCGTTTCCGATCGTGGATCACAAGATAGCGATGCGTCGGTGCATGGCAGGTATGAAAAAGTCCTACGCTATCAAC
GAGTACGGCAGTCCACCGGTCCCGAAGCCTCCCAGCAGCCCCCGCTTCAAGCGTCCACGTGAGAGTTCGTCCAATTCGTCAGAGACGTCGGAAGAGTCAA
CG