Description :
From Genome Similarity Track
Location :
Scaffold_101:59776- 60876
Transcript NameFunction/comments
g14985.t1hypothetical protein
g14986.t1hypothetical protein

Sequence
1100 bases(100 bases per row)
CATGGCCAGCTCGGGCCGCATCACACCCATCGACGCGATGCCCACACCAGACTTGGCCGTGCCGTACGCGGCGCCGAGGTCTGCAACAGCAACAACAACA
ACAGCAACAGCAACAGTTTAGAAACGCACTCTTCGACCCAGCAAATAGCACTGTAGCAGTCCAACAGCTACTACTACACTGCCACTACCACGGCTACAGA
TAACGTACTGGCGAAGACGAGGGCGGAAGCGACCCCCATGAAGCCGAAGAACGACGCCGACGACGGGCACACGTCTGCTACGAGTTGAGCCAGCATTGCT
TTTCTTTAAGGGTTCTAAGGTGCTGTTCTATAACGGAGGCAGCAATCGTGTAAACAGTTTGTTAGGTGGCTCTGGACATGAGTTACATGATGGCGCTGGC
GGCGCGGTCTGCTCCGCCCTGTGGAGCGCGATCCCGTGCGGCGCGCGAGCCGCCCCGCCCTGCCCCGACAAGCCACGCACCTGATTGAAATGTTGCGGAA
CTGCTTTTGAAGGCAGCGACGGTCCCCCCTTTTAGATTTTGAGCTGCTTACATTTGGCAAGAGGTTTTTCCCGAAAAACCTCGGCAAAGATCCGTTTTTT
GCCTTGAGCACCAAGCGCCACCAGGAAACGGACCCGAGCCGTGTGGTAGCAATTGAAGTGCACGAGCACCTTTGCGAGCTACCTTCATTCGACTGTGCAT
GTCCAGATATCAATCACTAAGAGCGGGTATGCGTCGCGCAGCAAGGCCACATCGTTACTGTAAATAGTGTTTTTAACACTTAACTAGGTCATGAGCCTAT
ACTAGGCTCTCTTCTGCTTTTCAATTAATTGTCATCTACGTTTCGTAGCGCAATTTAAAATTGAGCGCGCAGCATGGCTGAGGAGTACCGGCAGCGGCTA
GACAACAATGTGGAGAAGCTGGTGGAGAACTTCAAGGGGCTGATCAAGACGTCCAAGATCAAGGACTCGTCCAATACCACGCGCGAGTCCTTCCAGAGCT
CCATCTACGCCACGACCCTTGTGCAAGCGAGCGAGTCGCTGCTCAAGCTCGTGGCCGAGATGAAGCTGTCGCTGGCGCTCGGCGACTTCGAAGGCATGAG