Description :
From Genome Similarity Track
Location :
Scaffold_48:59752- 73597
Transcript NameFunction/comments
Phymu_g2625hypothetical protein PHYSODRAFT_534656
Phymu_g2626calcium/calmodulin-dependent protein kinase kinase, putative
Phymu_g2627conserved hypothetical protein
Phymu_g2628protein kinase, putative
Phymu_g2629protein kinase, putative

Sequence
13845 bases(100 bases per row)
CGACTGCCGGTCGAAACCCGACGCGGCGATCAGCACGCCCTTGTATGTCTCGCGGAACTGCCTGGCTGAGCCCTTTTCGGGCGCCACCGGGTTACGCACG
TGGTAGCCGCGCGGCTCGATGAGGTGAGCGTACGCCAGGTCGTAGTCGTTcagcttgttcagcacgtacgtgtacgtggcgATCGGGTCCGAGTCCTTGT
cgccgaagctgccgccgAAGGGAGACAGACGGATTCCTACCTTGTTCGACTCCACGCTCTCGAGGATAccatccagcgcctcaaaCAGGAAACGCGCTCG
ATTCTCCACGCTACCGCCGTACGCATCCGTGCGGTCGTTGATGCCGTCGTGCAGGAATTGCTCCAGCAAATAGCCGTTTGCAGCGTGCAGCTCGACCCCG
TCAAAGCCCGCAGCGATGGCATTCTCCGCAGCCTTGCGGTAGTCCGCCACAATTCCAGGGATCTCGCTGGCTTCCAAAGCGCGCGGCCGCACGGGCTCTT
TTCGCCCTTCGCGCGtgatgatcttcttgccggcgCGGATGTTCTCAagcttggagctggacgacacggGCAGGATGCCACCAGGCTGGTTGAGCGGGTG
TCCAATACGTCCAGTGTGCCACAGCTGCAGAAACATCACGCCGCCCTTGGCGTGGACGGCGTTCGTGACATGGCGCCAGGCCTCAACCTGCTCTGAGGCG
AAGATGCCCGGCGAGCCCCAGGAACCGCGACCGGTGGGCGTGATGTTGGTGGCCTCGGCGATGATGAGGCCGCCGGGCGTCGTCCGCTGCTCGTAATACT
TGACGCcgatctccttctggacGCCCTCCTCGCCCGTGCGGAGTCTTGTGAGTGGAGCCATGACAAcgcgatggagcagctgcaccGGGTTTTTCTTGCC
GCCGAGGGTCAACGGCGTGAAAAGCTTGGACGTCGTCATTGGCGCTGCGAGTGGCGAAAGGGGAAATGAGGTCATTCAGCGCAAGGTGATCGATCCGCTC
ATCGAAGCTTGCGTCATCCCGCGAGTCGTGTCAACGCACATCTTACTCGCATTCCTCGCTTCCTAGACCTAAAGTTGCAGTACCAAACCTTATGTTGCGG
AAAAGTTGCGGTGATGTTGATTATGTGCATTAAGGTTTTCTTTTTTCTGATTGGTTAAATCTTTTCTCTTTCGTCTCGGTGATCGTTTCCTGCTCAAAGT
TACGTCAAATCCATTCCGCCCGCCGTCTCCGTCCGTCGTCATGGGACAACGCGCCAGCACCGCGCGGGACAGCGACGTCTCCGAGAGCGACGGGGGTCct
ccctcctcctccttaCCCCCTCGCGCACCAGACGCGTCCATCTCTACACCTCAAGCGAATTCTCCACCTCCTACTGACGCTGACACAGGTCTCCACTCTC
TAACCGGTTTGTTATCGTCCAAACGGCCCGCTATCGACCCGCCCAAGGCCTCCACTGTTCAGCAGGATGAGCGCGACGGCTCCGTACCACTGGGAGACGT
GGTGCACGATGCAATCGGCTCCGCTAACGACCAGGAGCCGTCCGCACACCAGCTCCGGagcgacgatgaggacgatTTGGGCTTCCCGCGCGTGGCCTCG
ACCGACTCCTTCCCGTCTCCTCCACGCAACGTCAAGACGGATGACGCCCACCCACTGACCAGACGAAGCTCCATGTCGCGCACGCCGGCGCCGCCCAAAC
TCTCCCGGTTTCGGCCGTCCATGGACATCGCCAAGCCGCCAAGCTCCCCGCAGTCAGGCTACCAGTCCAGCTCGGATTCTCGCTCATTggactcgagctc
cagctcttctgaTGAGGATCTCGTGGGCAGCGGGGAGGAGCTCGTCAGTGACTGGCTCGATGAGCCTGAGGACGCCGTGCTGTCCCCGCCGTCCCACCCG
AAGCGCACGCGCCACGCGAGCGCCTGCTCCTCGGTGTCTTCTCACACAGGAAACAGCGTATCCTTCTCTGCTATGCACAGCAGCGGAGGacgcaacagca
acagcagccagcacagcATGACAGGTTGGGCTTCGTGGCTTAGCTCACCGGAtgacgtggaagaagaagatgatgcggACGATGAACCCGTGGCGCTCAC
GCCCTTCTTACGTGATAATATGCCGGTATATGAGGTCATGAAGCAggtgcagctcttccggaACTTGAGtcagatgcagcaggagcaggtcGTGCGAGCG
CTCAAGCCCGCCAAGTTCTCGGACGGCGAGGTCATCGTCGCGCAGGGAACCCGTGGCTCAAGGTTCTACATGATTGCAAAGGGAGAAGCCGTTGTGACCA
AGACGGTCACCACTAGCAGTCAGAGTATCACGGGATCAACTCCTACAAGTGGAGGACAGACCCAGGAACGCATGATCACCCACCTGAGAGCTGGTCATTA
TTTCGGGGAGCTGGCGCTGATTTACGACGACCCACGCACAGCCACTGTACGCGCCGTCGGcgatgtggagctgctgtacttGACGCAAGAAGATTTCCAG
CATATCGGCCAGGTGCATCTGAGtctgatgctgcagcaggtgccgTTGCTCGCACGTCTGAGTGCGCGGGACCAGGATATTGTGCTCAAGTGCTTGCGAC
CTGCGAACTTCAGCGATGGCGAGTACATTGTGCAccaaggagacgaaggcACGCGGTTCTACATGATCACGCGTGGCGAAGCGATTGTATCTGAGAAAGC
TGAGGGACCGGACAAGAAGCCCTACGAGAAGGAATTAACGCGGCTGTACGAGGGCCACGTTTTCGGTGAAATGTCCCTCATTTACAGCGAGCCACGCACG
GCTTCAGTGCGTGCGGTGGGTCCTGTCAAGTGTCTGTATCTGAGCAAGGAGGACTTTGACAAGTGCCTTCTATCAGACCACTTCCAGAGGTTCATCCAGG
AGGCGTACGTGGAGAAGGCTACGCGTCGCGCCATGCGTCTTCGACTGCAACAGCGCGCCAATAGCGCCGCCACTTTAGCGTCCACTCCCCAAGCAAGTTC
TGGCGCTGAGAGTTCGTCTAGCTCTATTGttgctccaccaccagcccCTTCGTCACCTGTGAAAGCCACAGAGACTAGGAAACTCGTGAAGCAGCGCCTA
AAAAACGGCCAGGTTGTGGTGAACAAGTACGTGATCAAGGGCGATTTGGGTCGAGGCACCTTCGGACGTGTCAAGCTCTGTGAAAGCCAGGAGGATGGGC
AGATGTACGCGGTGAAGATCATGCACAAGACGTTCGTCCAGCGAATGGCTGGCAAAGAAGACCAGCTCTATGACGTGCTCCGTCGCGAGGTGGccatcat
gaagaagctgaaccaCCGCAATGTTGTGCGACTTGTGGAGGTTATTGACGATCCCAACAGCCAGAAGATGTATCTCGTACAGGAGTATGTACAGCACAGT
CTTATGGAGGAAGTGACGCAAGCGCGTCGGCTGGGTGAGCCCATTGCTAGGAAGTACATGCGTGACCTCCTTACTGGGCTTCAGTATCTGCACTTCCACA
AGGTCATTCACCGCGATATCAAGCCGGAGAACATCCTCGTGAGCTCGGACGGTGTTGCGAAGATTGCCGACTTCGGTACGGCTCGAATGATTATGAATGA
GACCGAGACGATCTCTGGGGCGAAGGGTACGCCTGCGTTTATGGCTCCCGAGATGTTTGACATTGATGCAACGTACCAAGGCCCCGCTGTAGACGTGTGG
TCTCTCGGAGCAACGTTGTACATGATGGTCATTGGGCATCCGCCGTGGATGGCAGACAACGAGATTCTCCTGGCCGAACGtgtgcagcgcgtggagctGC
GCTTCCCAAAGGACGTAGAGCGCACGATGGAGCCTCACTTGAAGAATCTGTTGCAGCGCATGCTCACGAAGGATCCAGCGTTGCGGATTTCTCTGAAGGA
GTGCTTCACTCACGAGTGGACCACGAAGGAAGGCAGCGACCCGCTTGGCTTGATCACCCCGGAGAAGAACCTGACTGTGTCCATGGATGAAAGCGAACGT
GCTATTGAGAACATTCCGGAGCAGATTGACCAGCGGCTGACGGAGAGCCTCGCGCAGGCTCATCAACTGGTGAAGACCAGACAGGAAAGTGTGGGCCCAG
GCGTAGTGCGCACAAACAGCGGCCGGTATTTCACGGGTACGCCCGTGTCAGGAACACTGGGCTCGCGCATCCCTTCGTCGGCGTCGACCACGTCGTCTGT
GAACACAGTCGGCAGCAGCCCGAGCCGCGCGTCCAGTGAAGAAGTTTCCCGCATTATTTGCGCCTGGCGCCATCACAAACGTGTGCAGCTCATGGACGGC
CACAAGGAGCTGTCGGAGCGCTCGCGCGAGCTGCtgatcgagcagaagcgcatgGCTTTCTCAGCGGATCGTGCGAAGGTGACGGAGATCATTTTACCGG
CTGCGAAACCTACTGCACGCAGTCGCTACCCCAgtgcgtcgtccactgcaTCGCTCCGGCAGGTGCGAGAGTCTTCAGTATTGTCGTCGGCTTCATCCGT
GTCGTCCATGTCGACGATAGGTGGTGACACGCCTTCGTCGGACTCCCCGAGGTCGCGCTCTTTCCCAGCTGGACGCAGCAATTCAGTGGATAACTCATtg
ttggtgaagaagaacagtTTCCAAAGCCGAATGTTCAAGGACTCAGGAAACCTCGAAGGTTTCGGTCGGACATCCTTCACGTCTGTATCGCAGTTGTCTG
AGTTGGCAGCGACCCCCGTTGAAGACAACCTGGACCAACGTGGTAGCTTATCGTCCTCAAGCGAATCAgggaactccagcagcagtttaTCCAACACGGG
GTCGTCAGATGCAGACTTGATGAAGCGCTCACTCTCTAGGAAGAAGGATTTCCTCATGGTGACGTCCGAGGTGTTTCGTGACGAAGGCGGCGACTACCAA
ACTCGCAAGATTTTGTTCCAGGCTCGTGATGATGACTTCTCGGTGGCTTCCAGGGTACCGACCCACTCCAATTCAGGACATGAGCTACTTCCTCCTGGCC
GCGCGGGCTCAACCAACTCCTCAGCTTCGAGTCAAAAGCCTAGGAGGTTGGACAGCTCTGGGAAACTAGGCAGTGCAGGCAGCGGCAGTGCCATGGGGAG
TGCCATGGGGAGCGCCATGGGCAGTGCGCTAGGCAGTGCGCTAGGGAGTGCGTTAGGCAGAACCAAGGAGAGTCGGCGGTCCTTAAATGGGAGCGTCAGT
tccgtcagcagctcgtcacgGTCCGAAGGCAAcgtggaggagttcgacATGGATGGAATCGACTGCGTGCAAGTGACGGAGatcgatgacgaagacgacg
atgagaCAGTGAGCCACGGTATGCGCAAGGGCAGCGGAGCCTCTTCGCGTCATTTCCACCACGCGAGCGACAGTAGCCGCGCgaacagcagccacaacca
CAGTCACACGTCTGGCATGGGCGGTCTCTCGGATGCTGATAGCGATTCGGACGATTCGGATTACTCGGATGTGGAGTGCGATGTGGATGTCGACGCCACT
TTCAGCGAGCTGATTGCCTCGCCCAACCAGCTTGATCTGATCAGCCatgatgacgaagagatcGCGCCTATCGTGACTCACAAGCCTTCCTTGACGTCGT
TGACCGACTTCTCCTCGTCTTTAGATGTGGATAACAGCGGCAAGGTGCTTACTCTAGGCTCGTTGCATTCGAtgacttccagttcttcggcATTATCCAT
GGCATCCCCCGCGCCGGCGCTGGATATCGTTCAAGTTTACGTGAGCAGTAAGATTCGAGAAAACCTCACACTCTCCATCCGATCCGGATACGCAGAGGCA
AAGGGAGCACGCTCGTACATGGAAGACCGCACTACTGGGCAGACGACTTGCGATCTGTCGCGTTATCCGGACGCACTCGCCACCAACTACGCGTCCGTAG
CTTTCTTCGCTGTTTACGACGGCCACAACGGCACCGATACGgctgtgaagctgcagaatgaGCTGCACCATCGATTCTTcgctgaaggcgctggcttcgT
GGAATCCCCCGTGACGTGCATCTCTTCGGTGTGTGAGGCGATTGACAATGATAttttggagaagcagaaccagAGCGTCTTGCCGAAACGTAAACGCACG
ATGGCCGCGGACGAATTGCGACGATATCTCAATGCTGAAGCCAACAATTCTAGCCTTACTGAAGGCGAGTGCTGCGAGATTGACGGCGAGATTGTGTGTG
GAGACGAGATGAAGGCTCTGTTGCAGCCGATCTCGTTCTCGGGGGCTGCAAGTGTCTTCGTTGTGGTGACGAAACAGCGCAAGAAACGTCGGCGCACGAA
TGGGGACGGGGAAggtgaagatgatgatgaagccgGAGAAACCAAGGAAGAGAGTGcagtcgaggaagaagaggatcAGCCGACGCGGCTCTACGTGGCT
AATGTGGGTGACTGCCGCGCTGTTTTGTGCACTGCCGACGCGCTAGCAGTGGACTTGACGACGGATCACAAGGCCTCTCTACCTGCGGAACAAGCGCGTA
TCGAGGCTTCTGGTGGCTTCGTGCACAATGGGCGTCTGGATGGCATTCTACAGATCTCTCGTGGCTTTGGCGATCTTGCGCACAAGCAGGATGGGCATTT
GGTAGTGACACCCGACGTTGTGGAGCACCTCGTGGACCCTTCGGAccagttcttgctgcttgcaAGTGACGGACTCTTCGACGTCCTCACTTCGCAGCAG
GCCGTCAACTTTGTGCTGCGGAAGCTCCAGACCCACGGGGACGTGCAGCTCGCGGCGCAGGAGCTCGTGCTCAAGACACAGGCGTACTTCGCCCACGATA
ACGTCAGTGTGGTCATCGTGGCGCTGAATCAGAAAAACGACGCGTGAAATGGACGTCGGCCTCGTTCGGACAcaagcgaagaagaccggagaccgacgaa
gaagcaaAAAGACCAAAACAAGAGGAAAAACACGAGTGGAGTAAAAGTCTGCACGTGAAGCCCCGACGTCCAGTCTACCGATGGACCAGAGGAGAGTTGA
GGGCTTCGTAGTGCGACTGTGAATTAGTATACGTTTGATAATGACCCCCGTAGTTTTACCTGTTGTCTTTAGGGATTTACTTCGTGCTTGTCTCTTCCCA
CTGCTCGAACTCGTCCCAGGAGCGGAGTtcgtcctgctcctccagtaCAAACACAGGAGACGGCAagtccaaggacgacgtgTGGCTGTCGTGATGCCCC
AGGTCGAActccacctcgtcgtccgcaCAGGCGGCGTCCAGTTCGTCGATGGTCATGAGCGTTGTGGCGTTGTCAGGCCGCGTCTCCATCATTGTGATGT
CGCTCAATAGGAATGGAACCGCGCCACCGCCAAATGTCCCCGGCGCGTCCCGGAACGGCTCCCGTTCGAGTGTGAAGAACGTGCGTAGCTGCACGGCGAA
TCCGAGAGCCACCAACGGGCAGCGGCGCGTGGACGGACTCGTAGCGAGCGCCAGAAGTCCCTGCAGGTACTGGAAGAACTGCTCTGCACGCTGTTGGACG
ACCTTGGGGCTCTTGGAACCCCAGAGCCGGCGCTTAGGGAAGTATTTGGAGCTCAATTtgtccagagcttccatcATGGGCGCGCAGTGCGGACAGTGCG
CGTGTTTGCTGTCCACGGCCGCGCCCGGGTGGTTCCGCCGATCAAAAACGCGCGCCAGTTCCTCCCGCAGCGACCTGAAACCCGAATACCGTCTCGAGAC
GAACCACCGCTGGCCGACGCCCGAGACCATCGTGTCCTCGAGCACGAGTTCGTACTCTGTGTGAGTGCCGGGCGACACCATCGACGTGTACTGCAGAATG
GACGACTCTTTCGGCGTGACCGAGTGCAGCACGAAGCCCCCTAAGTGGTTGGCCAAGCTGCGCGGACGCTTCTTGCTGGACTtgagcgacgacagcgtgg
acgcagtggacttggacgacgtgctAGTGGACGTCGAGCGCGGCAGCCGACAGCTGCTTGACTTGTGGCTGTCGTCGCTACGGCTGCGTCCGAGCGCCAC
GCTGGACGGATAGCGGCGCATGGAGTCGAGCAGGACGCTCGAGCGGACGCTGGTGCGGCGCCGGTCGTTGGCCGTGGGCTCTTCCCAGCTCACGGACTTG
TTGAGGTGTCGAGAGCTCGAGTTCTCCGAGGAGGAtgtggacgaagacggcgagtCCAGGAAGAAGGACATGACGGACTCGGACACGGGCATGGGCATGG
GCGGCAGTGGGCGCCGCGGCTTgggcttgcgcttctcctccatcgccgGCGAGTTCGCGTGTATGTCGAAAGCGCGTGACAAGGGGGGGAACATGTGGTC
GCGCGGACCAGGTTGCGGGATCCGTACGCGACCGGCGCATCCCCCTCGGGTCACAGAGTGGGATGTGATCTGTCAGCAAGTCACGAGGCATACATGCATA
GCCGCGACGAACTTCGGTGGACGTTGTCCTGACGGGTTCATCTGACCTTCATGGACAACAATCGAATGTACTAGGTAGGCTACAGTCTGTAGCTGATTGT
TTTCAAGCCTGGGTAAATGCCGCCAGGATGTGCGTGGCGCTCTCTCTCAGGGCTCATTAGAGAGATTTTTGCTCTCTCCTGGGATTTCACCTGCTGCGAC
TATCATTGTTTGGGCCAAAAATTCGATGGTCCAGCTGGCGAAAGTGCAGGAATTCAACGGAGCTCGGCACTTTTGCACGCAAAAGTTATCCGCTGCAACG
CTCGCCAATACTAACAGATATTTCCTTCAAAGCACTGTGAATCACATTGTGATTGATATGAAGaagccagcgcctgcacaTGGATATTAGTTGGGAGTCC
CAACTTAATCCGCGACCTTCAGAGCACAAGATGTGGAAGTTCCTGAAGTTCCACTGGAATTTCTGCGCAGCTCAACACGATGAGAATAGCCACTCCGTAC
AATACGGACCAATTTTACGTGTTCATGGATGTACCTGTACTGTAATTCGGCGCCCAGCACAAGGTTCATTGGCTTATTCGTCTTGGTTATCTCTGCTGCA
TCAACGGTGGAGTGACTCCACTGGAGTCACCGTGGACACTTCAGGCTGGACGTTCAGCCTTCTTGTTGACTTGACACTCTTTGGCTTCACTGTGGGAAAG
AAGTCGGGCCAAGGATATTGCCGGAGCATGCAAGGCGCGCACGAGAGAACGGATCTATGCATCTCCACCGAGATCGTTGCATGTAAGCTCAGCCtagtgt
acatgtaggctGACGCTGTTTTGAGTCCAGATGGTCGCAAAGTCATTTCCGTGCTAgggaagcagaagcgcagcCTCAATTGACATGTTAATTGGCCAAC
TCCGAGCCAGAGtcacttgagcagctcacaACGATGCCCCACGGGCCATCGCGGATAGCCGCGCGTGTAAAGTACGTGGTGGTTTGCTTCAGTTACATGT
ATAGCACTTTACGGCATGAATACCTTTTTTATCACTTGAGTACTCCGAGAACACCGACGTAGTAAAAGCATCCAAACACTGTGCAGCCCTTGCTACACAA
AGTGGCTATTATCGATCAGCGAGCCGCGAGCATTTTGGGAGCCACTAGGCTTACGGCGCAACATCTGATGAGTTTAACGCCGTGACTTGACCACAGATGA
TTTTTGCATTCCGTGGCGGTTATTATTGTGTGTCTTCATATCCTGGCACATTCGTGATCGGAGCTCGTTGCGATCACACAGCTACGGAGGAGGGGGCCAG
CCGCTTTGTCGACTCCACAGAAAACCGGATTGCCCCGCACCGTGGAGATTCTCCACGATCAGAAACCCAATTTTGATTCTCCATTTACATTTAGTTTTTA
CAATCCAAATATTTGCAGTTGAATGTCATGAGTTTTACGCCGACGACCGTAATTTACGGCCAGGATATCGCCTCCCAACGAATTCAATGGACCGATACGT
CATGTACGAGGACCATTCAACAGACCTGCTTACAACGGCGTTGGAGCTCGAAGCGCGTACTATTGCGTAACGAATTTTGGATCCACCTCCAACCCAtgtg
atgctgttgctgtgaAGGGTCAAGAAGCAGTTTGATGGTCAGAGCTTCCGCCGACATATTTCCATTTTGAGCTGGATAGGTTCATCGGAGACTCGTGGCG
CATTCGGCCGCTTGatttcttctttctcgtcGTTTTTTAAGCCGCCACGATGGAGGCTGTTGAGATCTTCTCAGGCGAAAACTGTGCCGGGACGCCGGAC
GTGTTGGCCATGTACAACGTCACTGCGACGTGCGTCGAAGACGGATGCAGCGGTATCGACTTTGGCAACAAAACGTACTACATGAGCCGGACATGCGACG
TACCCGATCGATTCGCGCACACCGCCAAGATTTTCGGAGAATTCGACTACGTGATCATGGAAACTTACAACAACGAGAGCTGCACGTCGTTCGGGGAGGC
GGACGTCTTTCTGGCGTCTGGAGGGTGCGAGATCTCGTCCGGATTCGGAGATCAGTCGGTTATCACCACGCTGTTCTCCAATGGTTCAGCTCTCGTGACG
CTGTATCCGAACGACGCGTGTGGAGGTGAACCTTCGCTGTATTTCAAGCTTGACAGGGCAGCATTGGCCACAGGCTCCTGTCAGCAACATCTCTACCGGT
TTTACAGCAGTGACAGCGGTTCCGGGGTGGCGTCAGGCTCTACAAGTTGGAGCGATAGTGGCAGTGTGGGTGTAAATGATCCACAAGAGAGCAGCTCGTC
CGGACTGGATAACGGAGGCAAGGTGTCGACTGATTCCGGCATTGGGACTGGAGTGATTGTTGGAATTGCAGTCGCTGCCTTAGCGTTTGTACTTgtcgtg
gcgctgcttgtaAAGTGGAATCTTTCTAAAAAGCAGGAAGATGAAATGGAGAGGGACGACGGCTTCAACGCTTTCAGATCCCCTCAAGTTGGTCGGAAAA
ATGAATCAGTAACAGACCCAAGAACGCTGGATTCGCCTTGGGTTGACGGCCACAGTAGCGGACAAAAACCTCTCAGTCTCGTGGGTTTATGGGACGACGA
AGTCATCGCTACTGCTCGGATACCTAGAGAGAAAGTGGTCGTTCAGAAGCCCATAAACcgcggaggaggaggggaAGTATATCTCGGACTCTTCAATCAA
CAGCAAGTGGccgtcaagatgctgcttcCTGAAATGCGCAAGAGTGTCAAGCACGTGAACGCTTTCTTGGCCGAAGTGAAGCTCATGGCGACGTTGGATC
ACCCTCGGATTGTTCAATTCGTGGGCGTGGCTTGGGACTCGCTCACGGATTTGTGTGTCGTCTCGGAGTTCATGGAAGGAGGAGATTTGAGAGAGCTTTT
GACGGTTTACGAAAAGGAAAAACAACCTACAGGTTTCGACCGAACTAAAGTGACGATCGCTTTGCACGTGGCTCACGCTCTCACGTATCTCCACTCCCTC
GAGACGCCAGTGCTTCATCGAGATCTCAAATCCAAGAACGTTCTGCTGACGTCCGATCTCGAAGCGAAACTCACGGACTTTGGCATCTCTCGAGAAAGAG
TCGACAGGACAATGACGGCAGGTGTAGGAACTTCTCTGTGGATGGCGCCGGAGGTGATGCTTGGGGAGAGATACGACGACAAGGCCGACATGTTCTCGTT
CGGGGTTTTACTGTCCGAGTTGGACGTGCACGTGCTCCCGTACTCGCACGCAAAGGACAACAGCGAGCCGCACCGAAAAATGCCCGAAACAGTCGTGTTG
CAGATGGTTGCGCTAGGCAAATTACGGGTGAGGTTTTCTTCCAACTCTCTAGAGTCGATGGTGGCGTTAGGCTTATCGTGTGTGTCCCTGGACGCAACGG
AGCGGCCAACTGCAGCCGAAGCACTTTACAAACTGCACACGACCCTTTCGCAGGAATTGTAGGCAAAGTGAAGAGTTTCTAAAGTTTAGGCTAAAATGGA
CTGTTGTCTTGTGCAAACTCTATCCATTCTCCTCTTGATGGCGCAATCCGAGGTACTGAACCATTCATTTTACGCACCAAAGGTACAGAATCCTAGGGAC
TATTCCTATGGatatgtaccggtatgtgtGTGTCAGGCTGGCACTGCCAGCATCATCCATCGGTGTACAATGTACACCgatgtacactgtacatgtacat
gttgtATGCACGTGTACGacgtacagtactgtacagtTACCGTAGGAGGGAGTTCTCGAGGTAGTGAACCATTTTGCCACTTAAATTCTCTTCCTGCCTG
TCTGCTTTTGCCACATAGTGAAACAGTGTTTAAACTGAACAATCAACGGGAACCGCACGCCATGTGGTGCATTTTGCCACAAGTGAATCGACAAGATGCG
CGGCATATTGACGCTGGCCTTTGTGGCGATGGCAGCCGCCGCCACTGCCGACTCGGTCATGCAtggcttcagcgtcttcgatAAAAGCAACTGCGTCGGG
ACTCCGTTGGTTCTGTCCATGGCGATTGAATCCGGCTGCGAGAACCAGACGTGCCAAGAAATGGACTTTGGCGATGAAACCTACTACGTCTCCATGACGT
GCGATATCTCGGACCGATTCGCGTACGCGCGCGCCTCCTTTAGCGACGTGGAAACGTATGTCGTTCTGGAGAACTACACAAAGCCTGGGTGTGAAAATCT
CGTCGAGACACTAGCGTTAGTGGCAAGTGGAAGGTGCCAAGTGGGCAACACTGCGGGCACGAAATCCTTCATTGCCAACTACGTGAATAATGAGTTTTCT
ATCGCGTATTACCGTAACGATTCATGCGGTGGAGAGAGTTATCAGAGCGGGACTGCATCCAGTCTCAACATTTCAAGAAGGGACTGTATAGATCCAGGCT
ACAGAGTGTACTCCAGTGTCAATCCCAACGCTGAATCTGCCAGTGCAAGCGCTTCGGATAGTAAGAATTCAGCTGATTCTAGCAGCAGTGGTGTCATCAC
CGTTGATACGACTACCGAGAGCTCGGGAATCGGTTCAGGAACTATCGTGGGAATTATCGTCGCTGTGGTGGTCGTAACGCTCTTCGCTCTTGGATTCGTG
TGGTATCGGAAGAGAAACCGAAAGGATTCCGAGGAAAATGGGTATGGGAAAGTGAACTCCCCGATGTCAGACCCCAAGACAAACGAATTCGACGAAACAG
ACTTCGCTGCGTCCAAAGGACCTCAATCTCTCGCGAGTCTTTGGGACGATGAAGACATCGCCACTGCTCGCATTCCTCGTGAAAAGGTGGAAGTGCAGTA
TCTAATCAGTCGAGGCGGTTATGGAGAGGTTTACTACGGGCTTTACTTCGGGGCACCTGTAGCTATAAAGATGCTGCTTCCCCAATTACGCAAGAGCGTC
AAGCACGTGAACGATTTTCTGGATGAAGTGAAATTACTGCAAAGACTGGATCACCCACGCATTGTGCAGTTCGTCGGGATTGCGTGGGACACTCTGGCTG
ACTTGTGTTTCGCCTTGGAATACATGGAAGGCGGCGATCtccgtgctcttctcgtGTCCTACGAAGAACAGAACCTCCCAGTGGGTTTCGACAGAAGTAA
AGTGACCATTGCGCTCCACGTCGCTCACGCGTTAACGTACCTGCACTCGCTGGACCCGCCCATTCTCCACCGTgacctcaagtccaagaacatTCTGCTG
AGCCCCGAACTGGAAGCGAAAGTCACGGATTTCGGTATCTCTCGAGAGCGAGAGGACAAAACGATGACTGCAGGCGTTGGGACATCATTGTGGATGGCGC
CAGAAGTGATGCTGGGTCAGCGGTACGACGACAAGGCCGATGTTTTCTCGCTCGGCGTGGTGCTGTCGGAACTCGACCTCCACGTTTTGCCTTATTCCCA
CGCGAAAGACAGTAGCAACTCTGGTCGAAAACTCCCGGACACGGC