Description :
From Genome Similarity Track
Location :
Scaffold_121:597428- 604126
Transcript NameFunction/comments
Aphin_H310_11302Hypothetical protein
Aphin_H310_11303PREDICTED: uncharacterized protein LOC100249189

Sequence
6698 bases(100 bases per row)
TGGACCACGACAACAGCCACGTGACGGACTTTCCGTCGCCAAATCTGTTTTTGAACGTCCAGCAAGACATTCTTCGCGCCCTCGAAGAAGGACCGTTCCA
GCGGTACATTGCCGGCCGCGGCTACACGCGAATCATCGATCGTACGATTCGACGATAGAGATGGATAACATGAGCGTTGTGGTGGCCGAAACATGGGGAT
TGGCGTGCGCGAATATGCTGCATTGTGCATCTCTCGCAAATCGAACCCGATCACCATGTTTGGTAGATTGACGGGGCGTAGCGTAGTGAAAACCATCCAC
AAAAAGGAGGGCGGCTTGGTGATGCCAGGATGTTTAAAGCCCGAGCGCACTACATGGATGTAATCATGATTCTGTTGCATGCAAACAGCAGCCAGGCCAC
CGATACACGCTGTGCGCTCTGGCATGGGCATCGAAGCCGTCGAGGTTCGACTTCCCCCCCTCAGTACGCTACTTTGATGTCCATGAGGAGCCCGGGCGTG
GTGTCGCGCCCTCCAAACTTGGCAGTGTAGAACGCCCATTTCGTGGCTTGGAACGTGGGGCTGCCACTGAGGACGACAACGTCATCGTCCAGCGCAGGCA
CGTCCGAGCTTTGTGGCGTACGCATTTCACCTTTACGTGGACTGGGGCAGTCGGGAGGCTAACCCACATTCGTGTTCGCACCGGTTGGAAAGACATGTTC
GCGACGTACGACCGCAGAGAGCAACTCACGACGCGGCAGGGTTCATTTCCCCCATGTCGGACGCGAAGTGTACATTGAGTTGGTGGTGTTGCTGTCGTAC
CTAGGCATTCATCCCACAAGTGCATTTGCCTGCCAACGATGCCACCTTGACAATTCCTTGGAGGACACATCGCTGTACGACAGCTCAAACACTGACAAGC
ACCCACCAGCCAGCACCTGTGCTTTTATGCTATTGCTTCAACCCCACTTGACCAGATATCATTCCAGCGTCGACGCGTTCGGGCTGTAGCGATGACTGGG
CGGCCCAAGGGAAGCGTACCATACACCTGCGGCAACCCCCACTCGATGCCGTGGCTGTGGCATCGCGTTGGCCTCATCTTGGCCTCCATCCTGCCCCTCC
TCAGATTTCGCGAACGCTCTATTCCACATGACCTGTGTTGTTGACGCGCCGGCACAATCGCATGTCGCAAACGTTATCGAATGTCGCTGGCCGCCCCGGT
AATATCCGTGTGGTGGCCACGATTTCGCCCAGGTCGGGGAGATTCTGCCAGCAACGAGTTTTCACGTAGGAATGTGTTGGCAGGCCCCAACCGCTGTCGC
ATTCAGTTCAAGCAGCTCGGCGTCGAGAAGGTGCGCATTGCCCGGAGCAGACAACCTCGCTTCGCCTGAATACACAAATATGTATTGATCGATACAAGCC
CAAGTTCAAATGTCGCCGAGGAGGTCGAAGATGTTGTGCAGCACGGTGGTGCCGTGGCAATAATGCGGTGATGCCCACTGTGGCGCCGCCGTGACGGGCT
GTGGTGTTTCCATGCCGTGGATCAGTTGCATCAGCGACAGCGGTTGAAGGGGAATATGAGTGTCGAGCTGTGAAACGTCAGTCGTCGAGTCGATCGAGAC
GAGCGGCGTTGTCAGCAGAGATGCCGGGGCTTTCTTAACCGTGAATGTGGCGTTGTCGCCCCACAGCGACATCATATTGATGCCATTCTTCGAAGGGTAC
GCGGTCGGAGACAGCTTCCCCGACATGCGATGGCGCTGACAGAACCCCCCCGCTCTCGCATGCGCTGTGCAGCCGGAGAACTTGCATTGCCGCCCTCCGC
CGTGCTTGACACAGCGCTGTCGGGCCTGCGCGGGCTGCGGACACCCAGGTTCGATGCACAGTTTCTTGGTTGCGCCGTGCTTGTAGCACACGTTGTCAAA
GCGAGCGCGTAGTGAGCAGCCGTCGACCGCACATTCCTTCTTGGCACCGTGGCGGCAACAAAGCTGCCGTGCGTATGCTTGGTTGGTGCAGCTGTCGATG
ATGCACATGCCGCGGTGGCGGTGAAGCTTACACCGCCACGTGTTGGGGATGGCCGTGTCATGGCATCCTTGGATGAGGCACGTTCGCAGGAGCGAGTCGT
TCGGCATGTGCGCAGAGCAACCACCGACACTGAGGCGGAGAAATTGATTTTGGTTGACGCCGGAGTGGCCACCGTCCGGGCCGTCTGGGTCGGCCCCACA
CTCGCCCAGCAGAGAACATTACATGTCTCGGGTGCATGTCTCGCAAGTGGAGTAAGGGAAGATGCGGGGGGGTTACCCTCCCTTCCGTAAAACCAAGCCA
ATCCCGCCAGCACTTCGGACAGGTCATCGCAACGACCGGCTCCGAGTCAGGTTGCTAATTCTTGGCTTGAGCGTGATGATTTTTCACGGCCGCTGTGATG
GCGCTTGGATTCCCAGCGGGCATTCATCTGGCACCAGCAACGACCTCCAACGACTCGCAGCCTGCACAAATGTGAACAGCGCTCAATAACCCTAGCTTAC
AGTGGACAATCTACCCACGATCCCCTCAAGTTGAAAAGGGGGACAAAGACGTTTTCGTTCGAGGTAGAGCACTTTCCCTCCGCCTACCCCCAGGGAATTA
CAAAAACATCACGCAAACGAACAAGACGCAAAGAGATGGCGTCTGTTCGACCGGTTGGTTTGAGTTCTTGCCGGCTGTCGGTTGTTCGTACCCGAGGGTT
CGACAACGGAGGACGTGCTGCACTTCATTGAGAATAGAAGTCCAGCGAATGATAGAATCCAACCCCGCTTGGCGTATCGACGGGACTTTCAAGCGATGGT
GATGCTGCAGTGGCGTACATCGTTGTGTTCCAAGGCAAACAGCAACACGTTGTTTGAGATCCATCGGGATCGTCGCCACAAGAGTGGCCAAAGCAATCGA
GTAGCGTTGGCACAGTCCACTACTCGACATGAAGGTCATGGAGTACTCCATCCTGGTGCACAGGCCGAGGCTTTCGTGTTCGTGCAGGGGGTCTGCGCCA
GCCTCGACACTTCACGAAGTTGGTGCTCAGCGACATGGAGTCGACATGCTGAAAACCCACGTTGTGCAGGCGAGCGCGGGGGTGTATTCGTCCACTGGCA
CACATTGCCTGGAGGTGTTATGGCGGCAGCACAAACTGGCGACCATCGGTTCGACATAGTCATTGCACATGTCGCAGTGCCCAAGCTTCGTTGACGGCCT
GCGACAGGACTAGGTGAATCGCTATGGTTTGTGACGACCTATGGATGGTGAATGGCTGTGGTGAGGTTTCCGTTGTCGCGTCGTGAACAATCCCGTGGTC
GATTGCCACCTTTTTCCCATGATGGACTAGTGCTGAAGCAGACAATTCGTGACGAGTTTGCACATCATCATGGTTGTAAGACCACGACCATTGGAGCCCT
TGTAGTGTGTGCTTTGGGCGCCATGTATACTTGCGTGGCAAGCATTTGCCTTGGTGCCAAGTGAGTCCTCGAATACCATTGCATCGAGTATGTATGCATC
GCATGGCTATCAACACGAGGTTCGTACAATTACCAATCACGGTCGTGGTAGCTGACGTTGTAACGTTACCCTCGTCACGTGCCACGGCCTCGAGTGGTCG
ACAAAACGTCAAGCGAGTGGCAACGACAGTTTACAATGTGGTGTTGCCTTCTGCATATCTGTCCTTGGTCTGCGCGTACATTCCGCCGTATTTGGCGCCC
CAACTCTTGCCGACAGCAGCATCATGGGGAGAAGGACGAAGACTTATAACACGAGGCATGACGAGGTCAGCCCATGCCATGTCGACTTCTCAGTGCGTTA
TTCAGCTAAGTTATTCATTCATGACGATCACCATACTCACAGCACCTCCTTGCTCGCAGCTGGACGAGTTCCGTTGGCTGGCGAAACGTTGTATGAGATC
GTTGGTCGCGTGTATCCTCCAGGATGGCGTGGAACGCCATCCTGGAGGACTATGCACCGATTTATTCGTTGGGTTGATCGAGTTCGTATCAAATGCGAAA
GCGGTCGCCGACCTCGCAATTATCTTCGGCACCACACATACAACTACTCTAGTCGCGCATCCTCCGCAAAATGCGTGGCCAAGCTGTGGAAATGAGATTG
GCAGGTTGTGATGAATCGGTCGCACTCGTCGCTGGAACTAGGGATTCGACAGTGGAAATGTGCACTTGCACCGCTAATGGCATCGGTTTGATGTGGTCGG
CTCAGGAATCGACCATCCAAACTTTCGCGATGACGGTGTAGTGCGGATCGGCAGTCGCACGCCGATCCAGGGGTTGTCGGAAAGCGTGACGGGCTACCGC
AAACCTCAGACCCAAATGTTCGCAGCCAATAGAGGCCACTGGGCCTTGCCCAAAGGCGACCCCTCACCCTCGACAACCCTTGCGAGGGTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN