Description :
From Genome Similarity Track
Location :
contig_9:59730- 61604
Transcript NameFunction/comments
g2210.t1hypothetical protein
g2211.t1hypothetical protein

Sequence
1874 bases(100 bases per row)
AACTGGTGTCGCCTCTACCGAAGCTGACGACGAAGAGCGGGCTTGGACGATTGCAGGAGGCCTTATCCGCAACAAAGCCCAAACGAAGGAGTGGCTGAAT
TCGTTGCTTCAGAAGGGAACGTCCGTCGACGACGTGAAGGGCATCCTGGGTTTGAAGGGCTTATCGTTGGAAAGTATGATGAAGCACTGGAACTGGAATG
CCTTTGACAGATATTGGCGGTTGGTGCATGAGAAGGGCAACCGCAAAGAGATCCCGTACGCTGTTTTTGGATCGGGCGAGCAAACTAAGAAGAACACGCA
CGAGGTGCTTCTGGGTGGGTTCTTTCCGGAAAATCAGTGGAGGGGTCGGCAAATACCTGGGGGTGTGGGGATTGCCAAGAGCGAGCAACTCCTCCATCAA
AACTGGAGAGCGTTCAAAGCCTACCGTAAAATGTTCGTTCAATACGAGACGGGGTTGCAGAAAATAAAGGACCAAACGCAGTTCGCGTATTTCGACAAGA
GTTTTCGAGGCATTGACGAGGCGAAGGAGACGATAACGAAGTGGGCCATGAAGGGGTACTCAATCGATTACATCGCCACGACGCTGGGCTTGTCGGGCTT
GTCGGGGGCCAAGCTGACGAGCCACATCAACTACCGCGCGCTTGGTCTGTACAAGAACGACTTTTACGCCTTGGCATCACTGAGAGAAGCTAATGCGAAA
GCCAGAGCCAAGGCCAAGGCACTAGCCAAAGCGAGAGCCGCTGCCGGAAACGCTTAACAATGATAAGTGAACATCGCCATTAGAACTTCTTTGAAAATGT
ATGTTTCGTACATAAATGCTTCATACTGAAACCAAGTGGGTTGCCATTCTGAACCAAGTAGCATGGGGCGGCAGCCGCTGAAGGAGGGCGGCGGACGTAA
GGAGCGCAAGAATGTGCGCACGTCCACGACGTTCGAGACTCGACTGGCAGCGATCAAGCACTTCGAGGAGAGCGGCAACATGACGTCCACCGTGGATCGC
TTCTTCCCGGCGCTCACGCCGGAGGCCAAGCGCAACAAGAAGCGCGTCGTGTACGGCTGGATGAAGGACCGCGGCAAGATCGAGAAGGCCTGCGAGTCGG
TGAGCACCGCCAAGGCGCATCGCCTGCGCAAGCCAGGTCTGGGCCTCACGCTCAGCAATGACGCCGAGAAGTGCATCGTGGTGTGGCTGCGCTCACTGCT
GAAGCTGGGCGTGCCAGTGACAGGAGCCATGCTGTCCGAGCACGCGCTGGAGGTGGCCAAAGAGCTGGGTATTGACAACTCATTATTCACGGCCTCCGGC
CCTTGGAGGAAGAGCTTTCTCCGGAGGCACAATTTGGCCATGTAGATCGGGAATCGCCCTGACGAGCATGCAAGTGCCCACACGAGTGCATGAGAGGTTC
TCCTGTGTTAATTCCATGTATTTTTTAACCCCAATATATGCAGGAGGTACATACTGGGCGTTTGATGAGGTTGCTAGACCATACGTGGTGAAGAAATTCC
TTTCCGTGTACGCAGAGCTTAGCTTATCAACAGTTCAGCGCCAGCTCTGCTTCCTCCAACCGGTTGCGAAGTTACATCCATGTCGTCTTAATGAGGTAGT
CCGGCACCTCAGCCTCTTTACCGGTGAGCGTGCGCGCGCACAATTCACCCTCACCCTTTCATCTACGTGTAGCGATCAGTCGTTGCTTTTTTGCGGTCTC
AAATGGCTACACATTTGGCTATTGTTGTAATAAATTCAAAGGGTCATCTTATCGGCTCAACACGTCACAGCAAACCTCAATGCTGCCGTCGTACTCGCCT
AAAGGCCGCAAGCGCTCGCAGCAGCTGCAGCTCTGGAAGCGTGTGGGGCTCATCGGCGTCGTCTGTATCCTGGT