Description :
From Genome Similarity Track
Location :
contig_68:59722- 62431
Sequence
2709 bases(100 bases per row)
CTTAGAGTGACCACACCGGTAGTTGCTATTGCTATCCTATATTTAGCAGCGAAACCACATGTCCCCTGGCTGATAGCATCAGCCAAAAGCCAATTTGACA
CCGGTGGTGCGGCTATTAACTACGTTGAAGCTATGGTTGATCAATTTTCGTCGTCTTGGTTGACGGACTTGCTTGATGAGGGGAATGAAGAGGAAGCTTT
TGTTCTGAATTTAGTGTTGTCTAAACCTAGAGGCTTGGATTTGTCGTCGTATCCGAGTGGTTCGAGGCCAGGCAGAGCCGCAAACAAGGATCGTCGAGCG
GCCGACCGTCATTTATGTCTTCTGCAGCAGTATTTCGGACCAAAACCAGTCTACGACTCATCAGCGTTCCGAAAGCGCTTTCGAATGACCCAACGTTTGT
TCACAAAGGTGCTGATAGCAGTCGTTGAGACCGATGACTACTTCGAACAGAAGGCTGACGCTACCGGTAAGCTAGGCATCTCGAGTTTGCTTAAAGTTAC
TGCTTCATTACGACAACTTGCATATGCATCTGCTGCTCACGCGCTTGACGAAAACTTGGAGATAGCAGAAACTACGGCATTAAAATGCTTGAAACGCTTC
TGTCGTGCTATCATCGCGCGGTTTGGCAGTGCATATCTTCGGTCACCAACACCAAGTGAATTACAGGAAATTCTACAGGAAAATGCTCGCCGTGGTTTCG
TTGGGATGATAGGCTCAGTAGATTGCATGCACTGGCAATTGAGAAATTGTCCGACTGCACTGGCCGGACAACACAAAGAGAAGGAGAAAAAACACACTAA
GATTCTTGAGGCCGTCGCAGACTACAACTTACGAATTTGGCACTGCAACTTCGGGTCTCCAGGTTCTCTAAACGATATCAACGTTCTGGACCAGTCTCCT
TTGTTTCAAGATTTTCTGCAGGGTACTGCTCCCCGTGTCGAGTTCATGATATCTGATACGATGTGCTTCTTCACATTGGCTTTCTTAATTACTACAAACT
AAATGTGAAACTCGTAGGAAAGCCGTATGACACGCCGTACTTGTTGGCAGACGGAATCTACCCTGAATGGCCTGTGTTTGTCAAACCTATTGAGAAACCC
CATGGATTAAAACAAAAGCACTTCGTCAAGCGACAGGAAACTTGCCGGAAGGACGTGGAACGATGCTTCGGTGTGTTACAAGCGCGATGGCGCTTAATTG
ACACTCCCTGTCGTCTTTGGCGGGCAGATGCAATGGCCCACGTGATGCACGCTTGTATAATCCTCCACAACATGATCATAGAAGACGAGCTCAGTGATCC
CTATTGCAATGGGCATGAGCATCTTTACGATGCCGAGGCGCAGCCTGGTGGCATTCCAGTATTCAATATTGTTAGGCCACAACGACCACCGCGATCTTCT
ACAGTTGCTACGCTGATATCTAAATCGCACAAACTTCACAACGCTAACCAGCACGCTCGGTTTAAATCCGGGTCTCACAGATCATCTCCTGGACAATGCG
CGGTCTCGAAAACTAGTTAAAATTTGCAATATACGACCCTTGTGGTTTGAACTTAAGCAGTGCTAGATAATGAGCGATGATACAACATCGGGTGTTGTCG
TTGCAGTAATTGTGGGGGATGATTGGGCTGCTGGAGTTAATGGCGCGGTAGTGATGGGCTCTGCTCTGGCTGGATCCGGCTGATCACCAAGCCGAGATCC
ATGTCCTGCAGCTGCAGGAGTCTCTGTGTCAACAGCAGCAACCTCTTTACGAAGTCGTGCTAACACAAGTCGTCGTTTGAGCGCGATGAACTCCATCGTC
TCCGGGTCGCTAGTGTTTGTTGCCATGCTAAAAAGATTCTGATCAACTCGATCTTGAGCCACACGAACGCGAGCATCGGCTGTTTTCGCCATTCTTTCGG
TGGCTTGCACTTGTCTAGAGTAGAGAGCTAGGTTTGCGCGCTCCATTTCAGCACGCTGCTGCCCGATGGGGCGCTTATCTTCTGCTTCTGTTTCTGCTGT
TGATGTACCGTCAGATGTGCTACTCCCGATACCGTCCACAGATTGTAGTTCAGTCAAACATTCGACTGCCGTCCGCTTCCTGAGAGAGGTCTTCTTGGTG
TTTCCGTCTCGCCAAAACGCCCCACTTTGGCGAGTCTTTCAAGATGCTCCAGCACTGCAAGAACCGGAATTTTCCGCTCTCAGCTTCGTACAGCTCCACA
GCTTGATGAATGATGTCCGTTGGAGATCTACCACTAACATCCAGCCGTTCCACCTGCTTGAAGCAACCGACAAACTTCGACACAGACCGCGAAATTGTCT
GGAAGCGCGACTTCAGCGAGCCAGGATTTCTCGTAGTAGGAGTCCCTAGAATTTCTTCAAACACCTTTCTCACCTTGTGATACATGTCGTCTCCGGTCTG
ATTGATCCCAGTTGGAGGATCACAGCTAGCATTCAGCCATGCCTCACACAAAGCCTTATCCTCTGCAGCACTGTAGTTCGCTCCTCGTTTCTCGGACATC
TTGCAGACTGTTCACCACTCCGCTGGTGCTATTTTCAGAGACAAATTTAGCTCTAGATGTGGCCCCGATGGCCTCAAAGCTAAATCTGTTTAGCTTTTAG
CCGCCCCGGTGGCGCTGTGCAATGCTATCCTAGTGCCAAATCTGGCATTTTGGGGCGCTAACAGCACCCCGGTGTGGTCACTCTTAGAGTTTGTAAGGAT
CAAGCTTGG