Description :
From Genome Similarity Track
Location :
Scaffold_122:597- 2861
Sequence
2264 bases(100 bases per row)
GAAGCATTATCTGCGTAAGCTGAAGGCGGTATTTATTGATCAAGTGAGCTTGATCACCGAACAGTTCACCGATTCCATCCTGGCCGACTTCGCCGAAGTT
TTTTTCTTACCACGATTAAAAAGTGCAGAAATCAAGTCAGCACGTAAAGGACGTGTTACGGCGCAGTCTTTTGGACGATCTGAGCGTGTCTGAGAACCAC
TCTTACGCGGTAGTCTGCGAGTATGCCGATGACTTTCTGGACAAGATCCCCACCGAGATCTCTGCCAATCAAGGCGTTCAGCCTAAATGTAAGGTGACGC
GGAATTGAAATCTGCCGCAAGACCAAGTTAAATCCATCGACTTCTTGAGGGTCGCCTCAAGGCGAGTCATGTGCGCGAGAGCAGATTTCCACATTCGAGT
CAGATATCCTGTGTTTAGAAGACCACCAACGGATGGCGTATCGTAGAAAATTTGAATGAGACCACCATACTGGCGCAGGCGTCGATCCTCCGAAAAGACA
TGATATTGAGCTCCATGTTGGGAAGCGTCATCTATAGTGCCATCGAATTGACCGATTCCTTCTATCGGAGACCGATGAGACCAAGTGACATGCCCCTCAC
AACAGTGAGCTCTCCAAGTGATATGCTTCTGTGAATGGCTGGTGATGCCACAAGGTGTAAAGAACGCTCCTGCAACGTTTAACCGCATGGTTTCCCATGT
GATGCGACCGCTCCGCATATTATCGTCAGTCTATTAAGATGATATATTCATTCAAAGTCGCGCTGAGGGTGACCTCAGCGCTGTTGGCGTCCATCTCAAC
CATTTGAAACTAGTTTCCCAAGTCATGCGGTAAAACAAGCTATACGCGAACCTGAAGAACTATGTTTTTTGCGCTCAGGAGATTTCGGTTCTAAGGTGCA
ATGTAGAGAAAGAAGGAGAACGGGATGAACCGAAGAAAGTTTCATCCTTTTAATCTGAGCCCATTCCAAAGAAACCCGATATGTTGCGTCAGTAGCGTGG
ATTGCGGAATTACTTGCATAAGTATATCGAGGATTGCGGGACCGATACAACCACTATCTTTACTTGTCAAGAAATACGCCACAGCCACGTGGCGTCCTGA
ACATCAAGTCGCCTTCTGTTCCGTGATGAAGAGTGTGGATTCGGCTCCAGTCTTGGTCCTGCATGACGATTCGAAGACGTTTCACGTCTTGGGCGATGCC
ATCGATTTCTCAATCGGCTGCGCACTCATACAGTTTGACGACGATGGCCGCGAACGAGTCGTGAGCTATCAGTCACGACAACTGACGAATGACGATAAAA
TTATTTCGTTCACGACAAGAAGCTGCTGACGATGCTTACTAATCATCAGGTTTGTTTACTTTGTTGCCGAGCATTCGCGTTGTACTCTGATCATAGTTCA
TTGCGCACCGCAATGAATATCTGCATTTGACTCAGTGCATGGCACGTGAATTTTTTTTCTTTTGTAGTACGACTTTGTCGTACATTACTAGACGGGCAGA
GTAATATTAGTGCCGACAAACTTTCGAGACCTCCTGATTGTGATCCACGTCATATGCCTGATCGTCAGTGCTCTGGACGAAGAGTATGACAACTATGCGA
CTTGTGTGGCGTATGAATTTGACAAGATTTATTACCGAGTTGCATCTTTAAGATACAATCGTGGCAGCGTATGCGGGTGATCCTAACTGTGCCAATGTAA
TGAAGAACTTTCGCTCCCCAAATGACGCTTCATGCTCTCTCTCGTACCAAGCGTGATCACATCACGCGATACAGTTCCAATGTAGATCTGTTCATGTACA
ATATATATCGCATCGATGCTCCGCGTACAGTGTTAACTGATGATTCAGACCTACGAGCTCGGATAATTCACGAATTTCACGACGCCCCAGCCGGTGGTCA
TCTCGGTTGCAAAAAGCCTTTCACGCTGTGTCTCGTGATTTATATTGACTCCGCTTTTACGTGGATTCGTAGATGGGTTCTTACGTATGAGACCTGTCAG
CGAGGAAATGACATCTCCTTCGTCACAGGCTCCTGTGCGACTGCTTCCCATAGAAGCTAATGAATGGCTTTCGATACTAACAGATTTCATCCTAAGTACT
CCCGATAGTTAAGGTTGCACTGGTACCCTGGGTTTTCGTCGATCGGTTCAGCGGAATATGAATCCCCTCACCCTTGTTCTGACATATTCACCTCAACCTG
AGACCGCGTCGCACTTCATCACCGTCGTACATCGTCATCTCGGTCTTACGGAGTCTATTGTCTC