Description :
From Genome Similarity Track
Location :
Scaffold_290:597- 2344
Sequence
1747 bases(100 bases per row)
CTTCCTCCTAATCCACCCTTCCCCTGTGGATCCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTGGCCCACACCCTT
CCTGTGGGTCCTTCTTCATCCTACCATCAATATGACTAACTCACATCAACGGATCCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTT
ACGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAAGACACT
AGAAATTCACGGTAAATCCGTCCGGATCTAGTTCGCTTCCCTGACCTCATATCGGTGATCTTCTCGACTACGAACTCGTCGTCTTCGAGATCCACATTCC
AACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGATCTGCGGCCGATCCGGGTATTCTTTGACCAACTT
CAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTTCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGT
CCATGCCATAGATGGGCCAATTTGCGGGCGTATCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTAGATGTGGACGGGCAT
CCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCTGGTAGTATTTCTGGACTTGGTATCGACATCGCCTTGGATCTCG
GTTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTG
TCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACGTACATCTTGAGTGCTCTCGTGATCG
TCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGGCGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATC
AGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGATTCAGCAATGGTCTGCGCAGTT
CTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATAT
GATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACCCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACA
TTCCCAGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGAAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCC
AAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGG
GGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAATGCTGTAGGATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCAT
CAGATACTTTTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTT