Description :
From Genome Similarity Track
Location :
Scaffold_2847:597- 2040
Transcript NameFunction/comments
Phyag_g12844hypothetical protein

Sequence
1443 bases(100 bases per row)
CTGTTAAGACTCACCGCGGTCTGACGAACACTAACGCAGTGAAGATAAACATTCACTGGCTCGTGAACTGGTTCCGGGCATTTGCAGAGCAATTCGGTGA
CGTGGTTCCTGTGCGCGTACGGACTCAGAAAGCTATTGCAGGCACGATTCACAAACAGTATACGGACGAAAAATACACGCTTCTACCTGCATTCTTCACC
TAGGACGAGCTTTACACGGAAATGCACAGCTACGTGATCGAGAACGACTTGGAGGTTCAGGAGCCGCGCCCATCGACATTCAGGAagactctgcagcagt
gctgtCCTACAATTCGCATCCGGTCGCCAAGGAGCAACGTCTGTGACGTGTGCTCCATCCTGTATTCCAAAATGCGGTCCGGCGTCACAACAGAACTGAC
GGAAGGGCTCGGCGTCCacagagctgcagccaaagcAATGAGGTATGGATGCAAGAATCATCTCATTTTGAGGTGGATTCTAGGATCACTTTGATTAACT
CTAAACTTTTTGTATAGGTTGGAGTGCCAGAGAGACCTAGACGCAGCGTCAGACGACTGGGCTGTGATTTGTATGGACTTCAGTCAGAACCTGACGTTGC
CAAGTGTGACTTCTACGCCTTCTCAATGGTACTTCTTGTCGCTGATTAGTGTGCACGTGCTCAACATTTACTATGCCAATCAAAGCATCCAGTACAACTA
CGTGTACGAGGAGTCAGTCGCTGGGGAGGGCACGGACGAAATTAACAGCATGCTCTATCACTTTGTGCAGCTCATTGTGATTGCGAACGGCCATCGTAAG
CTTATTATCTACGCGGACAACTGTGGGGGCAGAATAAGAACAACTACGTCATCAAGATGCTCTTGGTATTGACTCAAATGGGGAAattggaggagatcga
gctgAAGTTCTTTATAAAAGGACACACCAAGAATGCAGTTAATAGAGGTTTTGGGCACATGAGGAAGAAGTTCGCTAGGGAAGATGTGTGGGCGACAGAG
GAAATGTTGGAGGTTATCAACGCGTCGTCTGCGAGTTCAGCCCTTGTGCACATACCAAAGGGCAACAAGGTCATGAAAGTGTTCAGGGACATCGTAAAAG
AGTCCTACAAGGATATGACCAGTCTCCAGAGCTACCAGATATTTGTGATGGCACAAAGCAAGCCCGGAGTAGTTAGCTGTCGTGCTGGCCCTGATGACGC
CGCTGTAGAGCAAGATTTACGGCGCAGGTTTGACGGAATCCCCACGAATGACGCTAAACTGCGTGGCCTCTTCGAGCACCACCTTGAAGATCTacaacca
ccaccgccacattttgaaaagaagcagcagatgcacaATAAGGCCAAGCCTTATGTTCCCCAGGAGTTCAGAACAGACTCTATCTACGACGCTCCaactg
acgaagaagagcggtTGGCGAACGAAGCAAAGCAGGCTCGCCG