Description :
From Genome Similarity Track
Location :
scaffold_624:597- 1879
Transcript NameFunction/comments
g9558.t1 hypothetical protein PHYSODRAFT_256278

Sequence
1282 bases(100 bases per row)
TCTTTTTCGCAAGCACGCCGTTCAGTTTCTCCACAAGCGCGTTTGAGTGGGTACAAAGTCAATCCCGTGCTTCTTCAGAAAGGCCCCCAGCTCAGCGTTC
ACAAATTCACCGCCGCCATCACTAGAAAAGGTCTTAACCCTATGTCCTTGAGCAATCAGTTTCGTCATCAGGTTCATTGTATCCTTGTTCGCATCGCTCT
TCTTCATGATCGGGTAGCACCACTTGTACCAAGAGCCCTCGTCTTGTATCAGTTGAAAATAGCGAATTCCACCAGATCCAGATATGTACTTGCCTATATC
ACATGTGTTTGACATCAGACGCTCGGATTTCACAGTCGTCCTTTTGCTCTTTGCATTCTTCGTGAATGGCATGCGTCGTCGTTTTGCTGACATGCAGGGT
AGGCACTGGAACGGCTTCTTGAACAGCTCCGCAGGAATGTCCATGCCGTCCACCAACTTCTGGTCCACCATGGCCTTAATTGCAGCCACATTCAGGTGTC
CCAAGCGCTCGTGCCACCTCATCAACGGGCTGGCGTCGGCGTTCAACGTGGTCATCACCATGTCCTCTGGCAATCCAGTCTCCAACCAATAATGTGAGCC
ACTTTTCACGAACTCCAATCGTCCAACAAGAGAATCCAGCTAACACTTGCGAGGTGTCATTTCAGCCGAGCTGAACGAAGGAATCAAGATCTCGCTCTCC
CAGGAGAGCCGGAGTTTGCCTAGTCCTGGGCGCCCGACGACTGGTCAGCGAGTCCTCGCCAGACACAGGTATGGCGAAATCAAGTCAAGTGGTCGACGGG
GGTAACCCGTCTGATGAGAGGCATCAACGAGCACAAGGAGGACAAGGAGGAAAGCAGGAGAGAAAGACAAAAGAGTAGTTTGAGGAGTAACAATTAATCT
CACTTCGGCATTTGCCCTCTCCACCACAAGCCTTAAAACCAACAAATACAGCCAGGTTATTTGCCGTAATGTCATCACGAATGACAAAAACTTGACATCG
CCGTCGGATCCGTAAGAGTCATCGCTGCATGAGTCCATGCATTCTCCTCGTCCATGTGCATGCAGTGGCGGCGCTTGCGAACACTCCCACTCGCTGCTAA
TGCTGCACGGCCGTGGCGAGGACTCCGCTTGCTTCGATCAGGTACTTGAGCCGCTTCATACCTAACGCCTTGGTAAGCATGTCCGCGAGCTGATCCTCCG
TCGGCACGTAGCTGGCTGCGATGACTCTTCGCGACACATTCTCTCGGATAAAGTGGTGTGGCGACATGGCTATAGGTCGCAT