Description :
From Genome Similarity Track
Location :
contig_68:59698- 62404
Sequence
2706 bases(100 bases per row)
CTTAGAGTGACCACACCGGTAGTTGCTATTGCTATCCTATATTTAGCAGCGAAACCACATGTCCCCTGGCTGATAGCATCAGCCAAAAGCCAATTTGACA
CCGGTGGTGCGGCTATTAACTACGTTGAAGCTATGGTTGATCAATTTTCGTCGTCTTGGTTGACGGACTTGCTTGATGAGGGGAATGAAGAGGAAGCTTT
TGTTCTGAATTTAGTGTTGTCTAAACCTAGAGGCTTGGATTTGTCGTCGTATCCGAGTGGTTCGAGGCCAGGCAGAGCCGCAAACAAGGATCGTCGAGCG
GCCGACCGTCATTTATGTCTTCTGCAGCAGTATTTCGGACCAAAACCAGTCTACGACTCATCAGCGTTCCGAAAGCGCTTTCGAATGACCCAACGTTTGT
TCACGAAGGTGCTGATAGCAGTCGTTGAGACCGATGACTACTTCGAACAGAAGGCTGACGCTACCGGTAAGCTAGGCATCTCGAGTTTGCTTAAAGTTAC
TGCTTCATTACGACAACTTGCATATGCATCTGCTGCTCACGCGCTTGACGAAAACTTGGAGATAGCAGAAACTACGGCATTAAAATGCTTGAAACGCTTC
TGTCGTGCTATCATCGCGCGGTTTGGCAGTGCATATCTTCGGTCACCAACACCAAGTGAATTACAGGAAATTCTACAGGAAAATGCTCGCCGTGGTTTCG
TTGGGATGATAGGCTCAGTAGATTGCATGCACTGGCAATTGAGAAATTGTCCGACTGCACTGGCCGGACAACACAAAGAGAAGGAGAAAAAACACACTAA
GATTCTTGAGGCCGTCGCAGACTACAACTTACGAATTTGGCACTGCAACTTCGGGTCTCCAGGTTCTCTAAACGATATCAACGTTCTGGACCAGTCTCCT
TTGTTTCAAGATTTTCTGCAGGGTACTGCTCCCCGTGTCGAGTTCATGATATCTGATACGATGTGCTTCTTCACATTGGCTTTCTTAATGACTGCAAACT
AAATGTGAAACTCGTAGGAAAGCAGTATGACACGCCGTACTTGTTGGCAGACGGAATCTACCCTGAATGGCCTGTGTTTGTCAAACCTATTAAGAAACCC
CATGGATTAAAACAAAAGCACTTCGTCAAGCGACAGGAAGCTTGCCGCAAGGACGTGGAACGATGCTTCGGTGTGTTACAAGCGCGATGGCGCATAATTG
ACACTCCCTGTCGTCTTTGGCGGGCAGATGCAATGGCCCAAGTGATGCACGATTGTATAATCCTCCACAACATGATCATAGAAGACGAGCTCACTGATCC
CTATTGCAATGTGCATGAGCATCTTTACGATGCCGAGGCGCAGCCTGGTGGCATTCCAGTATTCAATATTGTTAGGCCACAATGACCACCGCGATCTTCT
ACAGTTGCTACGCTGATATCTAACTCGCACAAACTTCACAACGCTAACCAGCACGCTCGGTTGAGATCCGATCTCACCGATCATCTCTGGACAATGCGCG
GTCTCGAAAACTAGTTAAAATTTGCAATATACGACCCTTGTGGTTTGAACTTAAGCAGTGCTAGATAATTAGCGATGATACAACATCGGGTGTTGTCGTT
GCAGTAACTGTGGGGAATGGGTGGGCTGCTGGAGTTAATGGCGCGGTAGTGATGGGCTCTGCTTTGGCTGGATCCGGCTGATCACCAAGCCGAGATCCAT
GTCCTGCAGCTGCAGGAGTCTCTGTGTCAACAGCAGCAACCTCTTTACGAAGTCGTGCTAACACAAGTCGTCGTTTGAGCGTGATGAACTCCATCGTCTC
CGGGTCGCTAGTGCTTGTTGTCATGCTAAAAAGATTCTGATCAACTTGATCTTGAGCCACACGAACGCGAGCATCGGCTGTTTTCGCCATTCTTTCGGTG
GCTTGCACTTGTCTAGAGTAGAGAGCTAGGTTTGCGCGCTCTATTTTAGCACGCTGCTGCCCGATGGGGCGATTATCTGCTACTTCTGTTTCTGCTGTTG
ATGTACCATCGGATATGCTACTCCCGATACCGTCCACAGATTGTAGTTCAGCCAAACATTCGACTGCCGTCCGCTTCCTGAGAGAGGTCTTCTTGGCGTT
TCCGTCTCGCCAAGCGCCCCACTTTGGCGAGTCTTTCGAGATGCTCCAGCACTGCAAAAACCGGAATTTTCCGCTCTCAGCTTCGTACAGCTCCACAGCT
TGATGAATGATGTCCGTTGGAGATCTACCACTAACATCCAGCCGTTCCACCGGCTTGAAGCAACCGACAAACTTCGACACAGACCGCGAACTTGTCTGGA
AGCGCGATTTCAGCGAGCCAGGGTTTCTCGTAGTAGGAGGCCCTAGAATTTCTTCAAACACCTTTCTCACCTTGTGATACATGTCGTCTCCGGTCTGATT
GATCCCAGTTACAGGATCACAGCTAGCATTCAGCCATGCCTCACACAAAGCCTTATCCTCTGCAGCACTGTAGTTCGCTCCTCGTTTCTCGGACATCTTG
CAGACTGTTCACCACTCCGCTGGTGCTATTTTCAGAGACAAATTTAGCTCTAGATGTGGCCCCGATGGCCTCAAAGCTAAATCTGTTTAGCTTTTAGCCG
CCCCGGTGGCGCTGTGCAATGCTATCCTAGTGCCAAATCTGGCATTTTGGGGCGCTAACAGCACCCCGGTGTGGTCACTCTTAGAGTTTGTAAGGATCAA
GCTTGG