Description :
From Genome Similarity Track
Location :
scaffold_35:59694- 60716
Transcript NameFunction/comments
Plaha_PHALS_01429glutaredoxin

Sequence
1022 bases(100 bases per row)
ACTACAACGAGCCGAAGTATGTATTACAGGGAGGGGGGTTCCTTTTTGACAAAAAGTCACCCATAAGTAATCTCCCTGTAGAGTATAGCGCCCCTAGCAC
CGAGAGAATGGTGGTCATCGCTCGAAGCCACAAGTCGGACTCGGGCAACACTGAATTCGCCATAATGCTACACGACAATACTGAAAGGAACAAACCGGAC
GATGATGAACCAGGCTACACGACATTTGGACGTGTTGTCGAAGGTTGGCACACGATCGAGTCCATTTCGAAGAAAATGTTGCCCGGATTTTTGGCTAAAG
AAGATCGCGACCGCCAGATTGACTTTGAAAAGGTTGAATTTGTACAGAGACTCACAAATGATGATTATGAAGCCAGAATGCGTCTTGAAGAGCTGACGTT
CGCTCTGGAGGCCCCCCATAGTGTGGTCATCATCTCTGAGAAGGACTGTCCGGAGAAAAAGGAATTGCAGAAAATACTTCACAAGTTCCGTACAACAGTG
CGCACGAAGGAGATTGGCTTTGCTAACCACATTCCGTACGAGCTTGAGGCGGTCGAGGCACTGACTGGTCTCGCATCGCTGCCTCTTGTATTCATTAATG
GCAAGTACTTTGGCGGCTTGCGTGAAGTACAAAAGATGGAGCAGACAGGTTCACTTCGTTTGATGCTGGAAAAAAGTGGCACGCTTGCTGAGGATACTGT
TTGGTCGGCCATCAACCAAAACCCTCTCGTGCTGTTCAGCAAGTCGTACTGTCCGTACTGCAAAAAGACAAAGGAGACATTGGCGAGCGTCGGTTCTAAA
CCCATTGTATTCGAATTGGATACTCGTGAAGATGGAGCTGCTATCcaagcttttctttttcGGTTGACGCGCCAGTCCACTGTACCCAACCTCTTTATTA
AGGGAAAAAGTGTCGGAGGAAATGATAATGTGCAGGAATTGGAGCGGTCTGGCGAATTAGTGGATCGTCTCAAAAAGGCTCGAGTCCTCGACTAAGATAA
CAGATCAAGGCAAAATCTAATA