Description :
From Genome Similarity Track
Location :
Scaffold_816:5969- 7771
Sequence
1802 bases(100 bases per row)
ATGACCTGTTCGACTTGGACATCGGAGTGCCAAGAACCACGGCCGCCGTCTCGACGGCGACAGCCGGCGGCGTAGCCCCCGCCCGCCTACGCCTCTCAGC
ATCTTCCGAGCTGAAAGAGTTCTCGGGACGGGACGCCAGCGAAGAGAAAGCCAGACTGTGGCTCAACCGTCTGAAGTCCGCCGCGCCGCGCGACGGGATG
ACGGGCGAAGAAGTGTGCGGGCAGTTCAGCGATCTAATGAGCGGCCATGCGCGCCAATGGTATCTCCAGTTGCCCAAGAAGGTCAAGAAATCATGGACCG
AGCTGATGGAGCAATTCCGGGTGCAGTACTGCGGCAAGGGCGTGTCAATGGCCAGTCGCTACTACCATGCGGCTCAGCGCCCCGACGAGACCCCTCTGGA
TTACTTGTACCGGCTCAACGTCGCGGGCTTGAGGGCCAACATCCCATACGCCGAGGGCACGACTGAAGAGAAGCGCGAACACGTCGAGCATTTCATCCGG
ACGCTGAACACGCAGGAGGCCGAACTCGCCTCGCGTCTGATGCTGATGGAGGTCGCCGACTCCGAGGCGCTGGACAAGAAGCTGCGTGCCCGACAACGTG
GATTGGCTCACCAGAAAAAGACTCTCTTCGGCTCGAACAAGTTCCGCCAAAAGGCGCCGACCCCGCCGACTCAGCCGGCGCGCGCCGTGCATGCGATCCA
CGTCGCGTCGGACGAGTACGACTCGGAACGCGAAAGTCGCGACAGCGACGATCGCCAGTGCGACCAAGACGAGGCGGACGAAGAACGCGCCAAGTTGTTC
GTCGCGGGACAGGCCCCGCCGGGAGAGCCGGCGCGTCGCAACTTCGATTCCGACGGCTCGGGACGCGACCGCCCGCGGTGCCGCTACTGTGGTTCACGTC
GCCATGTCGAAGGAGACTGCTGGAAGTTGTTGACGTGTCAGAAGTGTGGTGGCCAGCACCCGACGGAGCGATGCGTGAGGGTGTGCAAGGCCTGCGGTGA
CGTGCCCGAAGCCGGAGAATGCCCGATGGAGGAGTTCTTCAACCAATTGCGCCAGTGGTTTGACCCGAATAAACACGCAGGAATGCTGCCGCCGGCCGCC
GAGAAGATGTTAAACTAGGACGCTCGCTGGCTTGGAAACCAGTACTAGACGAGCGACCTGTTTCCGTCTATGCATATGTGACCAAGAAGTCGAGAGAGGT
GGTTAGTGAGAGCCCGACTTCCCTGAATGATAATACATGTGAATCCAACCTGGTACGTACCACGCAAGAACGCGCCCCCCGAATCTCGGCGGTCCGACGT
ACGACGGACGACGAGTTTGCACGTGAACCACCCCTGGACGAGATCGACTTGCAACCAGGAGAGCGACGCGGATACTGGAAACATTACGCGCCGCACAAGT
GGTACAAGCAGGCCAAGATTCATGGAAAGCTGAACAATCGCCGTGCTGTGTTATTGCTTGACACAGGTGCCGAGGTGTCCATCCTGGACATCACCTTTGC
TCGTGAGGTAGGCTGCCTGATTGACACGGAGGTCACGCAAGAGTGTGTGGGAATTCGTGATGAGACATATTACACGGTGGGGAGAACCAGAGTCAAGATT
ACCTTGGCTGGAAACTTGGTGTACTACATGCACCTGTGGGTCGGTGACTTGGTCGGCCAACACGCAATCCTGGGAATGAACTTCATGGTGCCCGCTGGAG
TGCGCATCGACACTGCGGACGGCACGGCGCGCCTCCCCGACGAGGTGCATATCCAGATGATCGGACGAAGACCGCTATACGGCGCACGGATGCACCCGGT
CA