Description :
From Genome Similarity Track
Location :
Scaffold_19:59672- 64561
Sequence
4889 bases(100 bases per row)
TAATCGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCCTATCTGCTCGTCAGGGCAAGAAAGAA
CTATCGGACTATGTCCAGGAACTGAGAACTCTAATCGCTGCTATGCAGCTTGATCCATTGCCAGAAATGGTTTTGGTTACCATCTTCATGGAGGGTCTTC
GCACGGGCGTGGCTCGAACGGAAGTATTCCGGGTACACCCCACCTCCTTTGAGGCGGCTGCGTATATTGCGTTGAACGATGAGTTCAAGTTCAATGTAGC
CCGTTTTGGCACCCACGGGTAAAACCCAAACTCGGCGAACTCATTTTGTTCATTCAAGAGGCCGGAGCCTATGGACCTCAGTCTCGCCGAGTGGACGAAG
AAGCAGAGCTTCGAGCTGTAGAACAACAATGAAACATTCGACGATGTTTCACGTGCGGAAGCTCAAAGCACCTGTGATCTAATTGCCCTTTACGTAGGAC
ACACCAGGCAACTTCAGGCTGAACGCCCGCCATTAATAAGAAGTCTAAATGGTGCGGGAAAAATGTAGACTCCCAGTAGGCGCGGGTCGCCCTGCTGGGG
AGGAACTAGGTTCTGTTGAGCCTCTAGGAGTTAGTGGCGAGCAGAATTTAGCCCCAAGGAGTCCCGTGTACTCTAATACGGGACATGAACGAAAGCCAGG
ATTGTTGGTCGCAAAGGCGACTGTTAAGGGCTTTGACAATCCCTGGTCGATTTTTATCGACTCCGGAGCATCTGGTAATTATGTCAGACGCTGTTCCCTT
GAAGGGAATCCACGTTATGCTGAGGCGATAAAAGCGCACGGGGGTGATACGATCACTGTTCGCTTGGTGACAGGAACTCTAGTCACTGCACCCAAAGTTC
CTGTGAACTTGTGTGTGAAGTTTTTCGATTTTGATAGTATCGAACGCTGTTTCTTGGCTTGAGCGCCATGAGCCATGTATCGACTGGAGGTCGAACACAT
TAGACGCCACGCGCACTGCCCCTAGCGGAGCTTTGGATAGTCATGAACCCACCACTACTAGGAATCAGAAGCGTTATTGGCGCGAGCCACTGGCTGACAA
TGTCAGTGTGCTGGGCATCGGAATGTCAGCGTTAGTTGATTCTGACGATTTCAAAGACATGAGGGATAGAGCAAAGATCAATATGTGATAGTGAAGCGGC
ACGTAATCGCTAAGTGATAGTCGTTGTGAGAGCAACATACTGAATGATGAAAGCATTGTTGACCAAGCGTCAAGTCATCGAGGGTTAAAACTATCAGATG
AGCGTGGGGGGCACGTAAGTACCAACTGAGTGACTTTGGCTGTGATAGCGACGCACTGAATGTCAATATTGACGTTGTTGGTGAAATACCAAGGCATCCC
GAGCCCGGATCAGCGGATGCGCGTGAGGTGGCACATAATCCACGTGATGACGACGTCATGTCCAATGACTCTTCATCGGATGTCAATAGTGACGTCAGCT
CTGTTTAAAAGCAAATTAAGTTCGATAATGGTATCGATCAGAGAGATACGAATCACACATCGTGTGCTGTGTCACAAAGTGATGACGACTGTCAGCTATA
TACACTCGTCAACGGAGTGACTGGTGCCTGTGATGGTACAATTAGCCTTGAGGCTATACACTCGTTAAGTTCGCTTTTAGAACTCAGAGAGTTGTCGGTC
GATGAGTTTGATCACTCACTAAAGAATGGAGACTTTTCAGAGGTGGTGGTCATTCGACCCGACATCACAGAGTTGAACTATTCTTCACTTTTAAATGAAG
CCGTTCTGGAGGACACAAAAACAACACCCAGTGCGCGCAGTGGGTCATCAATATTGAGAGACCCTCATGATCAAGGAATTTTAAGATGTGGTGTGCCACG
ACCCACCCTCGGTTCTACCTCCAGACAGAGGTGACCGTCATGAAATTGACTTAGTTCCTGGGAATAAGTACTGTGTCACACGACAGTGGCACTTTCCTAA
GGAGCAATGTGATGTCATTGTTGACTTCTCCCGTGCCAGCAAGAGGCAGGAATGGTACGTGAGAGTAAATCTCCACATTCAACACGGACATTTTGTTTTA
AAAGCCGAAAGGCAAGTGGCGTATTGTGCATGCTTTTAACAAGCTTAATGCGGCTACGATTCCGGCACAGACATCCATTCCTCGAAAGGATGTTCTTCAA
AACAACATGGTTAGTTGTACTATGTATAGTGCACTCGACTTGGTCGAGAGATAGTATCAATTGCCCATGCGAGCGAGTGATATTCCGCTTTCAGCAGTGA
GCACTCTGAGTGGTATGCTATGGGAATGTCTGGTGATGCCCCAGCGGCGGTCTTATGCTCTGGCAACATTTAATTATCTGGTGAAGCAATTTTTCCACCT
TATCAGTGTTATACTTAGACATACTTTGATGACACATTTGTCCATAGTCCTGCCGAACAAAGGTCGGTCAGATGTTGCAAATCACATCAGTCATTTGCGA
GTCGTGCTCGAGTGAATGCGCACTAATAAATTGTACGCCAGCGCGTCTAAATGCATTTTTGGTGCAGAAGAGATTCCTTTTCTCGGCTGTTTCATTACTA
AGCGCGGCCTTCGAGCGAATCCAGCTAAGGTCAAGCTATAGTGGACTGGTCGATTCTTAAGAATCAGAGGACATGCGTAACTGGCTTGGCCTTGCCAAAT
GCTTACACAAATACAGTGAAAATTACGCTAATATGGCTCGGCCATTAACTGATCTCCTTAAGAAGACCATCGATTGGCGCTGGTACAACACCCATGCCGA
CGCATTTCGTGCAATAAAGGAGAGTCTCCTCCATGCTCCCATTTTGGCTTTGCAAAATCCTAAGTACCCTTTCAGTGTTGTCTACAATGCATCCGACTTT
GCCATAGACAGCGCTCTGTTACAAACAGATGCTGCAGGCCGCGAGCGAGTTATCGCATTTGAATCACGTCACCTGAAAGCTGCTGAAAAGAACCATCCAG
TTCATGACAAAGAGCTACTTGCTATGAAGTATGCGCTCGTCAAATTTAGAGTTCATCTGCTTGGCTCCAAGCCATTCGTCGTCTATACGGATCATGCGTC
ATTACGCACGGCGACACAGTCACCTCACCTCTCTCAGAGAATGGCTCGCCAGAGTCATAGACTTCGAGGTGAAGTATAATCCAGGCAAACAAAATGTGTT
GGTAGATTCTCTCTCTCGCCGACCAGATTACGAGCTTGATCATGTCACTTCTTTGTCGTCTCCTATCGAGGATCCCATTCGTGTGGCCTATCCACGGGAT
GATCAATGTGTGGCATTGTTTCATTCCCCGGGGAGAGAGGAATACAAGGACTTGAACAGTCGATTATCGTTACGCTTGTGAGCCAGCCTGCATCGATATT
CCATCGATAACACGCTCTTGTGCTATAGCACAGACGTAGCGGATACCGCTCGCATTGTTGTGCCTCACAATGAGGATTTAAAGTACCGAACCCGCTTTGA
GCCCCACTATACTGCCCTCAGTGGGCATCTGGATTGGAAAAGGCATGGCTCTGTGAGTCAATACTACTGGTGGCCCAAACTCTACAAATGGGTGAGCACA
TACGTGCGTACATGCAAAACGTGCCAGCGGGTTAAACTCTCGGCACATTCGGCTGAGCCACTCGCCAGTTTACCTGTGCCCACGGGGTGTTGGGAGTCCA
TCAGTATAAATTTGTGTTTGGTCTTCCCAAAGACAGTGAAGGCAATACAGGAATTGTGGTCTTTGTTGACCGCTTAAGCGAGATGGCTCAATTAGCGGCA
GTGCAGGATTCCATCGATGGCAAAGGTACAGCTATGATGTTTATCGATCGTTTGTTTCGACAACACGGGGGGCCGCTGGCAGTCATCTCAGATCGCGACC
CCCACTTCACTAGCAAGTTTTGGACTTCCATCTTCAAGGTGCTTGGCACGCGATTGGACATGTTCACAGCGGATCATCCGCAGACCAATGGTCAAACTGA
GCGAGTTAATCGCGTCATCGGCGATGTTCTTCGTAGAGTTTGTGCTGATTAGCTTAAGACTCGGAGCTCGATGCTCCCTGTTATTCAGTTTGTGTTGAAC
AACGCTGTTCATGCCTCGACCGGCTTTACTCCATTCTATGTGAATAGCATCACGCACCCTCGCTTTCCGCTCACGTTACCACTCCGTGGTTTCGGGCTTG
GTGGGGGAGAGTCTGCTTACAAGATTAATGAAATCAGCCCTACCACCATGCAGAAACAGGTGAGCGAGTTTCTCACGACGCGCTTTAGTGTCTTAAGACA
TGTGCGTGATGCAATGAATGATATCCAGGAAAAACAAAAAGAACAAGCTGATGCTAAAGGCAGAGAATGTATTGATTCTTATGAAGTTGGAGACCAAGTC
TTACTAAATACTAAAACCTACCATAAATGTAGTGTCTTCCGTCTTCAAGACAAAGTTGCGCCCACGCTTCATCCGGCCGTTCACGATGATAGCGAAGAAG
GGCATTTCCTGTACACACAATCTTCTGCGCACGTTTCGCACACACCCAGTGTTTTACGTTGGCTTGCTTAAGCCATATCACGATCCTTA