Description :
From Genome Similarity Track
Location :
contig_25:59660- 64770
Transcript NameFunction/comments
g4889.t1hypothetical protein PHYSODRAFT_370933, partial
g4890.t1hypothetical protein PHYSODRAFT_514023, partial

Sequence
5110 bases(100 bases per row)
CTTCACAGACGAAATTGAAGGCGTTGCACACGCCACGCTAAGTGTTTTGGACTCCAGCACTCCATCTACAGGAAACGATGGCCAGAATCAGCTCATTTCG
TAATCGATCCGGCAGAAATGATTACCACTGCGGAGTGTGTCCACTGACACCTACGGTACTTTATTTGATGTCGTATACATAACATAACCCTTTGTAGCTC
TCCTAAGGCCTGGAATACAGTAAGCGCTCTCTGTTCCGGTACCACTTATAAAAATAATACCCCGAATCGTCTGATAGAATCGTTTTAGACAGGTGACACA
GCTTCACTTATGGCGGGAATCGCCACGCACCATTCATCTCAGCCGCGCCACACATCACAACACAAGCACTTCCTCGCACGCTCCGCCCCATGGGCTGGAT
GAGGATAGAGCAGAAGAGAGGTCTTATCAAGAAGGCACGCGAGTGTCCGGCGATGACCCAGGTGGCGCTCTCCGCCTGGGCCAAAGCTACCTACAAGCTG
AAGCGGGCGCCAGCTCAAACAACCATTTCCGACATCCTCAAGATGGCCCCGGCAATCATGAGCAAGGCGTATGGGGACGGCAAGCGGCGCTAACCGCTGA
AGGTGACCTCGGAGGCGCTGGGAGAGCGCCTATGGGAGTGGATACAGAAACTAGAGGCGTAGAACGTGTGTCTTTCTCGGGAGCTGATCAAAATGAAAGC
GCGAGATTTACAAAAGGAGCTATGTGATGCTTGGGAGCTGTCCTTTTCGGACGGGTGGCTCACTGCATTCGAGCGCAGGCATGGTCTTCGTTCTCGCTCA
CGACCTGGAGAAGCTGCATCGGTCGACCCTGAAGTCGTTTGCGTTGGTCTTCAACGGCTTCAGGAATTGACGGACCTATACTCTCCCGATGACGTCTACA
ATATGGACGAGACGGGGCTGTGCTACGCAATGGCCCCCGCTCGATCGATCTGCACAAAGACATGAAGAAGAAGAAGACGCGGATTACTCTCGCGCTTACG
GCAAATGCTGATGGATCCGACACGCTGCCGGCACTCTTTCTTGGTCACGCAAAGCAGCCCTACTGTCTCAACAAAAGCACGGTGGCACAACTAGGCTTCT
CGTACCGCTCGAACAAGAAATCCTGGATGACAGGACTACTGTTCCGGGAGTGGCTTCTCGATCTGGATCGCGACATGCGTGCGAAGGGCCGTCAGATCCT
GTTGCTGCTTGACAACGCATCGTCCCACCACTGGGGCGATATCGTGTGTACTAACGCCCGCGTAGAGTTCCTGCCACCGAATACCACGGCATTCCTACAA
CCCATGGACGCAGGAATCATCGCCGCGTTCAAGCGCGCGTACAGGGGAAAGCAGCTTCGTTGGGCGTACGAGAAGGTCAAGCGCGGTGAAGAGCTAAAGA
AGGACGTTTACACTGTCGACCAGCTACAGACAATGTAATGGAGCAAGGAGATCTGGCTCGAACTACAAGGTAAGACCACCATTCAAAACTGTTTCCGCCA
CACTGGAATAGTTTTTAATGCTGTAGATGAGAGGGACAAAGAGGACTAGCTATGGAACCGACGTTGATCTGGAGGATATCATCATTCGGGCTTCACAGTT
GAGTCTTTAAGTAGCCGACGATAATGCACAGCAAATCTTAGGATAGGGTCGGACCACGATACCGGAATTGGGAGCATATGCTGTACTATCAACAGTGATT
TCCGATGATCAGCAGTATTCAGACTCAAGGTTGCCAACTTTTGACAAAGCAGTATGCAGACTCAAGCAAGATGTTATCCTCACACTCAGTTGTCAAACGG
AGTACAAAGGCCCACCCTCTTGTTGTCGTTAAACGGCGTCAAACTTTTCCTTTTCAAAGCATCCCAACCGATTTCCATGATTTAGGGCAAATATTCATTT
TACCCTAGCCTTTTTCAGGCTACCCACGTGATCCAGTAAAACAATTCGAGCAACTATCAGATAAGATACCGGTGTGGAGTGCAGCATGTCAGCATCAAGG
ATTTGGAAAACAGTACCGGAAAGTTACGAAAAGGGCACTCAGATTTAATCGCCGCACGTAACGGTTACACTACCACAAACTGAGACTTCAGCACCCAAGA
CTTTACCTAAACCCGCATATGCTGAATTAGGACGGCGGTCTGCCGTGTTACAAAACTCATATGTCTACCGCATTACTTCACCAGGCTTGACCGTTGAATC
CTTGTTTCGTTTGGTTCGCTTTTCTTGGACGTATTCAGTATCACGGTGCATGCCATTGATGTTAGTTCTCGTGAAGCGGAGGTCTCGAGTTGTTTAAGCA
CAACTAGTAGAGTTGGAGGGCAGCGGCCAACCCGAGACAGTTCTCCCTCTCCAGCTCATTCTCAAACAGGTCGCTATTAGTGAAAGTCGAAGGGAAACTC
TCCCAGCGCTTCTTTTGTAATGCTGAGTGCTGCTTCACATCATTTAACTCTGGCGCACGGCTCTTACTTGCTAATGCCCTGAAGATGCAGCTGGTGCCGT
TCAGGCGTGTGTATAAGCTCCGGTTACTAACCTCGCCAGTCGCTGGGTGTGAACACAGCCGCTAAGCCTGACATCCAACGCACTGACGATTCTGGTCCAG
CTTGCCTAGTCGCGTTTGGTCAGCGTGACGGAGGCGACACGTCAGCAACTGGGAACGTGGCGGTGCCAACCAGTGTATTTCGTGGATGAAGATAGTGTAT
GTCGACGCCTCGCACCGAGGCTCATGATGCAAGTCGAGTGCGAGCGGTGGCACCATTGTCACGTGCACAGCTTCCGCGCTTACTGTGGCTGATCCCATCA
TTGTGTTGCTCTTGCGAAACGCACGCATTCCTCAAGACGAAATAAATATCTGGGTGATCTGGTGAACATGTTTGTGCAACCATCGTGAATTGCATATTGG
GCGATCCGGTGAAACCCACTGATCGTGCCAGCCGTCAGGTCGATGTCGTGCTGGCCGATCCACCAGGTTTCGATAATACCCCGGCGGCTGACCCACCAAG
TACGTGGATTGAAGTTTGCAGCGGGAATCAGTTCTATTTTACGTTTCAATGTGCGCTTGATTACATCCACTACGTCGGGTGACCCGATAATACAGACCAA
GGTGTATGTGCTCCACCAGTCTCCTTCCCTCGGCCTTTGATAGCAATAAATGAGTTACGACACCGATCACAGCTGCAGCGGTATCCCCCCTGTAACGGGG
TTACCTGAAGAGTGCCCGTCACTCTTCCGAGTTGGGTACATGGTGTACCCAACACCACTGACACGTGGTGGTGGCTCACAGCCACCCATACATAAAACAT
ATAGGATAAACTATAGTTGACTTAGGAATTGTATTGCAAGACGACCTCTAGGTAACTAACTATAAATATATCAGTCTATAAACTACGTTGTCTAAGTCAA
CCGTTCCCCAAGACCGGGAACTAGTGAACCGCCGTTCACTTGGAGTTTGTATACTTCTAACACTTCCTCAAGCGCAAGGTGCTGTGTGACTCCCGTCACA
CACACACACACACACACCAAAAAAAGAAGTTCTCTCTTCGGACTCGCCCTTTGTATTTTTTTTATTTGGTGAGGTGTATTGTGTTACTGTTTCCGTACGT
CCACTGAACTCTAATAACCATTCCAGCTAGGTGCCTATCCCCTAGCCAGTATTCTTTTGCGTGCCCGCCCCTGTCGACGCCTCCTTGACTCACTCCTACC
TTCCTGGGTGGTTCGACCCTCCGCACTCCTCCTGTGCAGCTCGACGTCCATCTTCTTGCTCCTCTCTCCACCTATTAAAATCGTTTGCCAAATATGTGCT
GACCCCGTCCTCAAGTCAACCCGTTCGGTGTCTCCTTCCGTCCCGTACATCTTACTCTTACCAGTATCCATAGCCTTGTTGGCCAAGGCATTCGCCATTT
TGTTGTGAGTTCTGTAATGGTGTGTCCAAGACTCCACCTCACATCGATCAGCTAGCTTCATGGTTATCTTGTACCAGTACTGCATCTTCCTCGTTTCGGC
TTCGTCCGCTCCTTCATCATTTTCAGCTATCTCCGACCACGTGTATTCCATTCCACTCCATTTTGACTGCCCTTGCCAAAAGTCTATGCAGCCCCGTAAA
TTCAGCTACGTTGTTGGTGGTAGCTCGACTACCAAGCGCTGTCGCCGCCGCCCACAACACTACAGGTAATACCTCGGCGCCCTTGTCCTCGACGATGATA
CTCCCACTGCCTCCCGCACCTGGGTTACCACGGGAGCCGCCGTCAAAGAACCCAACCCAAAGCACATCGTTCCTCTTCTCCGGCACTGCGACGAAATCCT
TTCTCCTCCAGTGCCGAAGGATTTCTCCTGCAGCCTGTATCTTGGTATATGAAGCGGTAGTCATTGGGTACAGTCCCAAACGAAAACGCTCAAAGGCTTC
CACTACACTTGTCTGGTATCGTCTGAGTTGGTCCGCAATCGCTGCAGCTTTTTTCCTTCTGGGTGAAGTCGATCCACATTCCATCGCCACAAAGCGGTCA
ACGTAACCGCGCAACCGAAAGCCCACATGGAGCAAGCACTTCGGTGACTTGATCCCATGGCTCCACCTCCTGCTCGACACCCCATGTAGTTAACCACCCC
GGCATCTTCTGCAACTTGAACCCGAACATTTTCATGATCGCCTCCTCTTGTGTGTCTTTGATTTCCCATCTCATGCACTTTGCACCCTCCCATTTTGCAC
AGTAGAACCTCAGTGATCTTGCGCCTCCTCGCAGTCCCATGCCAAATGTGCCGATCCCAATGTCTTGCTGTTGGTGCATCCAGCAGCAAGGCACTTGAAA
TTATTTTCTTTGCCGGCCCACAGACGAAGCCTGTTGTTCTTTAACCGTACCACCGTATGAGCTTGATAGGCGGTGACGCCTTCCATCCTGTGAATCCTCT
TCCATTTCAACTACTCTAGGGCCCGGCCATGCTAGCGTGATTCGCCTTCCACGCCTCCCCAATCTGAGCTTCGGCCTTGATCGCTGCTGCCTCTCTCCGT
TTACCAATGAACTTCTTGTAGGACTACCTACTCTGCTTCCATCTCCGCTTTCCAGCCCAAAGCGGCCTCATCCGAGTCAGCCATGGGTGGGGCAGCACCC
AGACGGACGA