Description :
From Genome Similarity Track
Location :
Scaffold_112:59648- 60804
Sequence
1156 bases(100 bases per row)
TTGGTTTCCGTGCACAAaCGAAGAACGCAACCCCCcAGTCCCACTCATCGCGGACGATTTTCGTGTAAAGCTTGCTTTTGATACCATATTGATGAAATTG
CCGCTTGACCCGAGAGATGTTATGCTGAAAGGAGACGCAGAATCATCACTTCCGATTCCATATTGATTCATCGAGCCTGAAGGATAAATAATGCGTGGGC
TTGCTTGTGATGCGCTACCTCGTGATCTCTGAACTTGTTGTTTCCCcTGGATGTTCAACTTCGAGGATAGATAGTCTTTTTGTCCCGCTGATCGAAATGT
TGAGTTAGCGATTAAAGTAGAGGCCGTCCcTAGAGTACATTAAAGGTGGACTGAGCGAAGAACGTTCAACGAGTATGTGGCAACGTACCATTCGTAGAAT
tATCGCTCTGATCcATTCCTTCATGGCCATTTGTAGGCGAATCATTTCCGTTCGATGGACTTGATACCTGAACTGATACAGATCTGGTAAGAGACTTCCT
ATTGATTCCTACTCGTGGCACTGCTTACATACCAGGAGCTGGGTAGACGGGACCAAACTCCTTTGATGGCTTCCTCTCTtTACTTGGATTTGAGGGTGTA
GATCTTGTTCGAGTCATTCCCTTGTCCATTGTACCAGAAGGCTTACGTGGGGTAGCATCTTTCTTTGATTTCCTGCGCTCAGTGTGAGTCGCTGAGGTAT
TCTGCTCTTCCGTGgGCTCAATGATGCCTTCATGTATGCTCATCTCTGTTGGCAAGGCATCAATTGGTTgTTCTGTGGTAGCTCCTCCAGGAACATCTTC
TTCCAAAGCTATTCGATCTCGATACACTTGTGCGACATCACTATTGACCTCCCGCGCGAGATCTTTTTCAATTTCTTCcATCGTGACCATCTTAGACTCT
TCAAGGATATCAACGGGATTGATGTCTGTGTAGTGAAGGTCAGCTACGGCAACCCTATCTGAGTCGCTCCCAGcAAACGCGTACCCTCAAGATCTCTGAG
CAGATGTCGATCATTCCATTCGAAAGTCAAACAATGCATAATGACATAGAGAAGGGAGATGTACTGCAAATACAAGAAGCGCATGAGCTCAGCAGCCTCG
TTTGATCcAGCgTCTTTGAATTTACATCTTCGGCGTCAACAGTGTCTGTCCACAAG