Description :
From Genome Similarity Track
Location :
Scaffold_964:5962- 7226
Sequence
1264 bases(100 bases per row)
ACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCG
TTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCCAGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACACCAAGGCGCTTGGTCTTTGTACGCT
TGGCTGCATTCGCCTCACGCAAGCGTTTCCTCAGCTCCACCTTTTCATCTTCAGTTGCATTGGGGCACTCGTTGAGCCAGTGCATCTCATTGCACTTTGG
ACACGGACTTGGAGGTAGCTTCTTCGACTTCGATTTCGTCTTGGTCTTGGATATGCTATTGGCTTGGATATGCTATTGGTCTTGGCCACCTTCCTTGAAG
AGTCCTCCGTATTCTCACCGGTCCTGATTTTCTTCTTTCCTTCGGGGTTCTTCTTCTTCTGCAGATCTTCATTGCGATCTCGTTTCTTATTCCTTTGTCT
TAGAAACTGGCGCTCATGTTCCTTCGCCTTCTCAACGACGAGGTCAAACAACAGTCTTGGAATCGAGGCGGCCTGCTTGTGCGTATACTGCAAACACTGC
TCCACTTCTTCCTTGAGAGCCGCTGGGTGAAGAGAGGCCACGAGTTGCTTGCACTTTGCCTCGTTACCCCCGTCACCTTCAAAGCAGGCGCCCAGACCAT
TTTCGCGCACTAGCTTCCGGAACTGGTTAAAGTAGTCCAGCACACGGGCGTCGACATCACTCTCCATCAGGTTCATCCTCAGTTTGGATCTGAATAATGC
CTTGACGTCAGGGAGCGTGTCATTTTTCACGCTTGAAAGGATGAGGGCGAACTCAGCAATAAGCATGTCGTCATTCACGTTAGCAACGTCCTCGTTCAAT
CTCAGCTCGCAAAGTACATCCAGTAAATCAGGATCCATTGAGTCGCGAACGGACTGGACTATGTTGTCATAATTTGATCCAGTAGCGCGGCATCGAGCTC
TCAACTTGCTCTCGTAGTGACGGCGCTTGTTCGTCCAATCAGTCAGAGCTTCATGAGAGATACTTGTAATTTCCGGTGCTACGATCGGTGTAAATACCGG
TGTACCAGCTCCTTGCATCCTAGCTGGTACTTGCTGAGGTTCAGTCCCACTCACGCCGAAATAACCACGATTAACCCTTGGGCCCTTAGCGGCTTGCTTC
GGTCGCGCCAAAAGAAAACCACAGTCACGACAGGCGAGAAACAGGCTCTTGTACTTGTTCTTGT