Description :
From Genome Similarity Track
Location :
Scaffold_23:596- 2602
Sequence
2006 bases(100 bases per row)
CTTCTTCGTCTTGTCGGACGCATCCAGCGCCCTGGCGGTCCCATCGGACGCCCTTGGGTCTGTCCAGAGGTGGGAACATGACTCACCAATGCTCTGTCAG
ACACAGAGGGCCGACTTAGCCTCAAGGCGTTGTCGCGCTACTCGACCGAGAGCCTGTGCAGCTTGCACGGCGCACGCAGGGCCAAGTCATACTTGCTCAA
GACGAGGGCATATACGGTTCCATGCCCAGGGCCGGCTTCGGCACGATGTCCGGGACGATGTACGGTTCCATGTCCGGGACCATGTGCGGTTCCATTGCTG
TCAGCGCCCTCGAGCGCGGCAGCCAGGGTCACAGCGGACCCCAAGGTTCTTCTTCGGCCCAGCCTCAGTCAATGAGACCTGACCTTGTGCTTAGACTCTC
TCGCAGAGTCTCGGCACTTGTGTCGTTATTCCAACCGACACATCTGGCGACGTGCGAACATCCACGCGACGTCCCAGACTCAATCATGTCTAGGGATACC
ATTACCCCCGCACACTCACGTGTACTACCGACAACCCACCGTTGTCCTTCACCAATGCGAGCGTCAGTGCTCGCAAGGGACCCCGGGTCTCTGTGGTGTA
CGCCTTCCGTACACCCATCACAAAGACTCGGGCCAACCCCAGCAAAGCCCTCGTCCTTACTGGTGGTTGTGTCCCCCTTGAGCACCTGACGGTGCATGGC
GTCGGCGTCCCCTTGACCCTCTGGTCTTCGGGTAGGTCTTCTTCCCAGACCCAGGCGATGGGCAGACACGTTGATAGTGTCCTAGTCCGCCGCAGCCGTA
GCAGCGGGCTGAGTACTGCTCAGCCGAACTCAGATCCATGGGTTCTGGTTCGCTGTCAGTGACCACAGGCTGTACAACAGCCAGAGCACCAGCCTGCTTG
TGGCTGTACTCTTCCTGGAGGGCGACTTGGATCGCCTCCTCCATAGTGGCGGTGCGCACACGGAACAACTGCGTGCGCACAGGACCGACCTTCAGGCCGT
CCACGAAGACTGTCATCTTGACGTCTTCCGACAGTGGGTTCCCCACCAGCGAGGTTGCCAACGTGTACGTACGCGTACAGCTCGTGCTCCCCTTGTTTGC
AGGCAAGGAAGCGCGAGCGCTGGCGGAACTCGTTGTTCGCCGGGAGAAAAGCGGCTCGAAGCTGCTCACACAGCTGAGCCCAGGATGTGAAACATCCAGG
CGACATCGCTTCGCGCGTATACGCCCAAGTCCTGGCACGTCCGCCAAGATTGGAGAGCGCGAAGGCGACTCGAAGGTTCTCGGCCGAGATGAGACCTGCG
CTCATTGCGATCTCGGTCTCCCGGATCCAGAAGTGAAGGTTCTCACCTTCCTTCCCTTCGAACGGAGGCACAGCTAGCCGCAGAGGCTTAGGCTGCACCC
GTTTGGGCTCACTCATCTGAGCCAGCAGGTTTCCCTGCACATGAGCGATGAGCCCGCGTTCGTACTCGTCAAACGCGCTCACCCGCTCGACCTGCTCGGC
TGGCGTCGCCGCCGCCAAGCTCCGGAGGGCATCTCTTCCGAAGATGCCCGCCATCTTCCGCACCGACTCGAACTGCGAGTCAGTCAAGTGAGGAAACTCA
CTTCGGTCCATCGTGGCTCACAGACCTGAGCCACCGAGGATTCAGGTAGACCAATCTACCCGCGTAGGCGTAGGATTGACTACAAGTGCTACCAAGTGTG
ACGGGGTCACACAGCACAATGCACAGAGGAAGTGCGTGCGGATATTACTATCCAGGTGAACAGCAGTTCACCAGTTCCCGGCCTCAAAGGGAACGGTTTG
CTACAAAGGAGTAGGTTATAAGACAGACTGTATTTTGGTAGAGGTTAACTTGGTCGTAATACAAACTACAAGTTAACTATACAAAAGCCCACACAAACTC
AAATGGTTGGCTTGCGGAGCTACTGGTACCATGTACCATGTACTCGGGAGAGTGACACCCGTCACTCTTCATGTAATGGGTACACTTGATTGTACCCCGT
TACATC