Description :
From Genome Similarity Track
Location :
Scaffold_1034:596- 2516
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_1034-abinit-gene-0.14Poly(A) polymerase

Sequence
1920 bases(100 bases per row)
CCGAGGTGCAGGCCAAGGCGCGCGTGCGCGAGCGGATCCAGGCGATCTTGGCCAAGGAATGGCCCACCAGCCGCGTGCTTCCGTTCGGCTCGTCCGAGAG
GTACGCTGGATAGAGTAGGCCTAGCGTGCGATTGAAAGTGGGGTGGACAGGGAGACTTATTGATGTCTTGTATTGCACTGCAGTGGACTGGGCTTTGGCG
GAAGCGACTTGGATCTTGGACTCTACTTTGACGACGTGGAGCTGGAGTACCAGCACCACTTCACGGCGTCGGAGCGACTCCAAATCCTCTCGACCGTCTG
CACGCGGCTCGCTGGCGACTTTGAGATTCGAGAGTTTGTCCAGCACGCGCGCGTGCCGGTGGTCAAGCTCTGGGACCCGCACAACCAAGTGGCGTGTGAC
GTCTGCGTTGGCAGCGTCCACGTCCTGCTGAACACGGCGTTGCTCAAGCTCTGCGCGCGCTCGGATCCGCGCGTGCGGCCGCTGGCGTTTGCCGTCAAGT
ACTGGGCCAAGCAGCGCGGGATCAACGACTCGGTGAACGGCACGCTCAGCTCATACGGTGCGTGGTGGTCATCTTTCCCACTCGAGGGTACTCACTCACT
GACTGGATGCCAATAATGCCCGCAGCATTCATGCTTCTCTTGATCTTCTTCTTGCAATCCAGTCGCGCTCAGTCGCTACTGCCGTCGGTCGCGTCGGTCT
TCCATTCTATCCAGACGGAGCGCACGCTTTCAGCTGTGTGCCACCGTCTCGACTCGCTCTCGGCGTCAGCACAGTCGGATTCGACCTTTGGGTCCACTGA
GCACGAGTCGGTGGGGGCCTTGCTGTGCGGCTTTTTCCGATTCTACGCGTGCGACTTCAACGTGGACGACGACGTTGTGAGTGTTCGCACGGGCCTGCCA
CTCGCCAAGGCCTCCAAGTGGAGTCGCACGCCGCCGTGGCGGATCAGCATTGAGGATCCGTTTGAGATTTCCCACGATGTTGGGCGCGTCGTGTTCAACC
GCATCGGCCAAGAGCTCCTCCACAAGGAATTTCGCCGCGCGTACGAAATGGCAATGGGCGGTCACCGGCTCGAGGCCATTTGTGCGCGCGACGAGACGAT
GTGGAGCTGCCACGCGACGTGCTACGTGTGCTCGTCGACGACCCACACGCCGCGCGAGTGTAGCCAAGCCATTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGTGCCGACGGCTCGACCGTAGCGATCGGCGGGAGGGTAAACGCCACTCGATCAATGGGCGATTGTTGGTACTGTGGCGGCACGG
GCCATGTCAAAGCGACATGCCCACTGTACGCATACGTGGCAGTGCCTAGCCCCGCCTCGATCGTTCCACCTGCCATGGCGGCGGTTGCACCAGCGACAGC
GATCTCTTCTCCGATCGCTATCAGTGTAAAGAATGTTCACGCGAATGCGGTTTGGCCAGCAGCGGTGCTGGAGCATTCGCCGGTGCGTGCCGGGAAGAAG
AAGAAACGGCCACGACGCGGGTCGATTTCGTCCATTGCGTCGTCGCCCGAGCAAGAGCACGCGCGCAAGTACATGCTGGCGGCCGGCCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTTGTCGCGCAAGTGTGGAAACGCTCCGAGGAGGCACCACGGTACGGCGTCGGTGCCCAGCGTGCCCTGCATCACGTG
AGGATCTCGATGGAGGTGCCAGGGTTCGCATTTTGGATTTTTGCATTTATCTGTCCTCGATGAGTCGATTCCGAGAGACGAGCCGTATTCATGGGTACGA
CAGTTGCGGCAATGATATGGATTCGTGTGTATCGATGCTGGTGGCCAGCGATCCGATCTCCATGGAGATACTGCACCCTGATTCAGGGTCCCTGAACTTG
TCAACTAGATGAGACTTGCT