Description :
From Genome Similarity Track
Location :
Scaffold_1013:5959- 10666
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1013-snap-gene-0.2Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1013-snap-gene-0.1Gene of unknown function

Sequence
4707 bases(100 bases per row)
ATCTCCTTCTTCGCAACAGCTACGCTGCGATGGACGGGAGGGAGGCGCGAGAAGCGAGTGACCGCAGACAGAGGGAGGAGGGGGGAGGAAGGAGGCAGAC
GCGTGGAGAGACACACAGGACGACGACGGCTCTCGTAGCGCTCGCTCGCTTTCTTTTATTTGCGCGCGCTTTCCTCTGCTCTCGCTCTGTTGTTGAGCTG
TTGTTTGTTGTTTGCTGGGCGTTTCCTTTTTTTTTCTCTCTCTCTCATGTGTCAGAACTGGCTTCCTTGTTTCCTGTTTATTTCTGCTTTCTATTTTATA
TAAACATAAACAGGCAAATATAGTAGACCTCTGATAACTGCTATGCTGCTGGAAGAGCATAAAAAAGTGTATATCGACAAAGCATACAAATATGTATACT
ATTGTAGCATAGCAATTTAGAGTATTACAAAAATCATCCATAATAGTAGTTATCCCAGGTCAAGCATAGCAGCTATTCGAAGTCAGCATAGCAGTTAGAG
GAGGTCAATTTAGCAGGATTATAAAGTTATTTCGCCGTGTTGGGCGTTTCCCGTTTGCAGCCTTTTTGTTTCTCTCTTTCCCACATGTTTGGTCAGAACA
CCCGCTGGCTTTCTGGTTGATAGGTTACAAAGTGGCGATGCCCGTTATAAAAGGTAATATGGACCTGTCTGTTATAGGTATGTGGTGGTGTTTTCCTTTG
AAAACCTATTTTTCGAGGCGATACTTGTTTACCTTTATGCCGTGAGGGCGGACAACAAAAAGCGAGCGGTTGACTTTGATGATCGTCCATTTGTGCACGG
GATAGGGTATTATTGTATCGACCTGTCTGCGTGCTTACTCTTTAACTGCATACGGTTGTTGTTGCTCCTTCTTCAGCTCGCAGGCTGGAAACGGACCACG
AACGCCCTGTACGCGCTTGGGGGTACAAATTCTCCTCAAGACGTTGAGAACACAATAATTTCGAGACAGCTTTTGGAGAGAGCTGCCCCACTTTGCAGAA
AGCGACTGAACCGTGGGCTATAAATCAGTTCAAAGCTGCTGGATTCCTGTTGTGCATGAGTATCTTCTCGCATGAATTCAGTATGTCTGTACGGAGGTTT
TTGTAATGCAGCTTGGAGCCAGTTATCCTTGTCTATCTCTGACGACTTTTTCACTTTGGCTCGAATTCGAACCGAGATGCTGTCCCATAGTGAAAGCAAG
TCAAACACGAATTCGTTCTGTAAAATTGAACCCATTTGAGTTCTTCATCAGAATACCGCACAAGAGATACGCAAATAATAACAAGTGATGCGAATAATAA
GCGATGCCAACAAGTCTCAGCATGGCGACGACAACACATCGCCATGGTGAAGCATGCGGAAAGGAGGGCTTGATCGATACTGCAGCTCAACGCCCCGACT
CATTCTTGCTGGGCTGTCTGAACATCCCTTCCTACTATATAATATATTCGGCTCGCTGTAACATCCAGTGGCGCAAGGCGCGCGCGTTTGTCTCCGTGAA
CTCGCTTCAACCCTTTTGACGTGCATATGTATTGCATGGTAATTCGTGCAGTGCAGCTGTACTGTTTGCTATCGCGTTGTTGTCTTGAGGATTCGTTCAG
AGCACGCCAGTTTTTATTCTAAAGCTTAAAGTTTAGAGTACCAGAGTACCGTGTACCGGTATATTTTCGGTATTATCGCCACCACCAGTACACTACTGTA
TATTTATGAACAGTGTCGCAAATGCATTATTTTAGCTCTTGAAGGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGCGGCACGATCGGCGACGAGGCTGTGCGCATCCTCGCTGTGCTGT
ACAACTCCAAGGCAGTGACAGTGGCCGAGATTGCAGCTGCCGCTGGAGTCTCAAAGGCCACTGTTTATAAGCGATTTGATGAGCTGAGAAGCCCCAGACC
GCCAGCGAATGTAGATCGGCCTCCAGCGCTGAACAACAACCAGCAAGTGGAACACAAGGCGTGGTTCGCAAGTCGGTGACTTGCGACTATCAATGAGTAT
CGAGAAGTCATCTACCAACGTTCGGGGTGTAGCTCAGCCATGACACCGTGAAGCGCTACTTGCAGTCCTACAGTATCCAGAATACAGTGACTTTCTTCGG
GGCTGAATGATGGTCTCCGGCTTGCAACGGGATTTCGGCGCTGCTGAGGCTGTGCTGCGTGCTATCAACTCAGCTACCAGACGCATTCTCGTCTGCATGT
ACATCTTCACGTATCAGCCGGTTTGTTTTTATTTTTTATTGTGTAAACACTTTTTTTAAATGATTTTTGTTCATGATGAACAGATTTCTGATGCGCTAGC
CGCGATCCAGAAAGCGAATGAAGAGAGCGCTCAGAACATACGGATCGAGGTCTTAGCAGACGATTCTGAGGCATTGGTGGAATGCTCTCAGATCATAGCC
CTGAAGAAGGTGAGCTTCTCGAAAAACAATTATTTGACAAGGCTTCATTATTTAATTATTGGTTTAATTCGTCTAGGCTCACATCAACGTGCGTGTTGAA
GCTTGCGAGCAGTTGACGCACAGCAAAGTGAAATTGGCTTATTGTTTGATTGCCTCCTTCTCTAATGTATGTACTTTGTTTTGGTAGTTCTGTTTGATCG
ACAAGGACACCCGGATCGATGGGACCTGCAACTGGTCCACGAATGACTTCAAGATCAAATATGAGCACATGACGATTTTCTACAAGGACGCCACGTTTGC
GGAGTATATGTGCGTTTTTGAGTTGATATCCCACGCTTTTCATCATCACAATGTCAACTTTGTACCTAGAAAGCGGACACGCACGCATGAAAGCAATTAA
TTTTTATAAATACATATATTAGGGGTAGCCAATCCTGGCAGTAAGTCAAGGGTTTTTTCTCGGTAACTGCACAATTTTCTCTTCTTGGCCTCTGATTGGC
TGATAATTTTTGGCCGATCTGAATCAAAAACGGCGGTTTTAGCGCCGCAGCAACAGGAAGAGATTTTTTTCGCGCGGGCTGCAGACTTCAACGCGCGCGC
CATGAAAGCTGTGTGCAAGAAGCGTGCATCGCCACATGGCCGCCTACTGCGAGGAACGTGCAACGCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCACTGCCTGAAAGCGCATAGAGAAGCTCGTGTGATCGT
ATACACACATGTTTATCATTATGCTGACTTATCGCTATGATGTCCGTGTTCTATGCTGTGTACGACGCGATTACCGAATGAAGCCTCTCGCACGTGACCC
AGGAATGGAGGCGTGCCAATACAAGCTGTGCAAGAAGATCACAAAGAGCGTCGAGAGCGATAGCGCCCTCCAAGCTTGCTGAAACACGACCTACCTCCTG
TGCGTGCCTCGCGCATGTCTTTCGCATTTGCTCGTGGCGATTGGTGCAAACAAGGAGTTCAGCGGCGTAGTTTGTAGCAAACGATGCTACAACGCTGAGC
GCAAGAGCGCGTTCGTCAGCTCAAGAGTGACCGACGCCAGAAGAACGAGAATCGCCTGGCACAATGACGGCCCGACCCCCGAGGTGAGCTCCTTAAGCTA
CTTGATGGGCTGGATTACCTTTGGGGCGAACTACAGCAGATACCAGGGCGGTGATGGACAGCACGGCGAGACAAANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
CCACGGCCCGTTCCTAAAGACATCCAGCCGAAGATCAAGCCTCCGGAGCACTCGTACAAGACAGCGGCCGACTGGCTGAAACACACGGGGCAAGGAATTG
CTGAAGAAGGAAGCTTGCATGGCGGCATTTTGAAACGATGTCTTCATTATTACGAGCCCTAGGCCATCATGGAAGATCGCCCGACCACGACACCCTTGCT
GCTGAACAGCGACATGTATGACAGTGGGGATGATAGCGAGGACGGTGGTGGTCTAGGTGATCACGACCGAGATACCAGTTCAGACTCTGGCGACACAGAG
TCGTCGAGCGGTGATTCTGCCGGCTCCAACTGGAAGCGTCCGGCCAGCGTGCCGATATCAGTTGCGAAGACGACCATGAAGAAGNNNNNNNNNNNNNNNN
NNNNNNN