Description :
From Genome Similarity Track
Location :
Scaffold_10:595706- 622730
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004566Protein of unknown function
Pytul_DAOMBR144PYU1_G004565translocation protein Sec63
Pytul_DAOMBR144PYU1_G004564Similar to ZNF207: Zinc finger protein 207 (Homo sapiens)
Pytul_DAOMBR144PYU1_G004563Similar to TPRXL: Putative protein TPRXL (Homo sapiens)
Pytul_DAOMBR144PYU1_G004562Protein of unknown function
Pytul_DAOMBR144PYU1_G004561Similar to scn1: Cut9-interacting protein scn1 (Schizosaccharomyces pombe)
Pytul_DAOMBR144PYU1_G004560Protein of unknown function
Pytul_DAOMBR144PYU1_G004559Similar to DSPP: Dentin sialophosphoprotein (Homo sapiens)
Pytul_DAOMBR144PYU1_G004558Similar to MRP1: Multidrug resistance-associated protein 1 (Arabidopsis thaliana)

Sequence
27024 bases(100 bases per row)
GAGCTCCTGGATATCCGCCAACGCTTGCTCGAAACGCTTCTGTTCTTCGGTGACGATCTCACCATCACCATCACCTTCACTAACGCCGGCCGTCGCATTC
ACCTTGACAGTCCCCATGGAGAACTCGCCGGAGCCAACACTGCTGCTGCTGCTGCCGCTGCTGCTGCTGCTGGCAAGACCCGCGGATGGGACAAAATTCT
TCTTGCACGCTTCGGTATAGTACGGCGACTGCTTCCACTCATCGAGCGAGCTGTAGCTCTGCGCGTCGATAGCAGCGACGAACGCCGTGGACGCGGCGAT
GAGACCGAGGCACAAACTGGACACGGACACCATGGTGGACGAGAAAGTAAAGGAGACGAAGAAACGGGGGTAGACTGCGACCTTGGAGGCGTGTGGGAGG
CTCACGTGGTGCTCCAAGCGAAGAGAATTCGAATATGACGGAGCTCCTCCCTTGTCCGCTTTCGCTGCCGTCGAGAGAGCGTTCGGTGCGCCGCGTGCGT
AACGAGCGGCGCATCACAACGGAGAGCGCGCAATGGAGAGGAGCAAAATGCAAATGGACAACGGCGCAACAGCGTCGGGACTACTTGACCACTTGGACTG
ATGCAATAGATACTTTTGGAGCTGGCGTCGCTGCTTTGTAGGTAAAATGCTGGTCATCTTTCCTTTTTAAAACGCATATTGTGTTTGTTCTTGTGGTTTT
TGATATTTTGACTGTATAAATACGCATATTATTTGATTGGTAGGAACCATGACAATCTTTTTAAATCCGGTAATTGTTCCTGATATTTTCCATGTCACCA
GCTGGAGACCACCAACTACTGGTCATAGTCAGAACGGCCGGTCTCTTGCACGACAGTTTGCTCTACAGGGTGGAACGTGAACCCTGTAAACTGCTCTGAA
TAGTATCATGTCTATAATACATACTCTGTTATAATACATATTCATGAATGAAAAAACATTGTTATTTACAAGCTGTTTTACCCTTCGTAATATTTTATTC
TTGTCATAATCGTTGAAACGCAGCATTTCGTCCATAGTGGTACAATCGAGAACTTTATGAGACCGCTCTCTGAAGAATGTAAAAACTATCTCAGCAGCTG
GTGGGTACCGTGCGTGGGTGGTGGCTTCACATACGCATTTCACACAGCAACACCAACAGCACTCCTGCTTCTTGTGTTGTAGCGCTTCAAGTGTACGGTC
CGCGACGACGCCCGAGCTCCCTCGACACCGTATTCGGTGGGGCTACACCACAGTACTATAATATCGTACTTATGTACTCCATCGTACAATGCGTGTTGAA
GAAACTCACACTTTGAGATGGCCGCGAAGTGTAAAGGCCCGCCTTCTAAACTGGATGGCGATTTAGTCTGTTAGTCACGCACACCGATGCTGGAGATGCT
CCATGGAGCGCTGCATTGGTAGAATGCGGTTCGGCAGTTCACTTTTCTACGTTGCAGTTATTACAATTCGAACGACCAAAACGTGGTTTGCATGCAGTCA
GCAGGTTGTTGTTGCCATGCGGAATCGGGCCATGCGGTCGAAAGGCAGCCGCTGGGCTGGGCAACTTGGCGTGTGAGAAACATTACAGTGGCGATCACGG
CGTTAGCAACAGCTGGCACCGAGCAAACAAACAGATCCGCACTTTTGCCAAGATGCGAGTGGAGGGCTCCCTCTCGTGAGGGGGTTGTTGTTGTTGATGT
GGACCACGAATCAGTAATGTGATGCAATACTGTTTTCACGTTGATATAGGTGACGATGATTCGAAACTCCAATATGCTGTTGTAGATGAGGGGCGTGTTC
AAGGCTTCTGGAAGACGATAAAGCAACTTCAACTTGGACACCTAGCTGATCTCTGTGTGTCTTGTTGAGACTCGGGATGCTGAAAACGCGTTCGTTGTCT
ATAGTACAACACTTCCTGAACGTGCGCCACCGAGTACTGTGTATCGTCATCTCCATTTTGCGACTCATCCGGAGCTTGCGCTGCGTGCACTCCTTCCACA
GCTGCTGTCGTTTGGTGTCGGAGCCGCCGTTGCGCCTGTATTTGTCACTGTCCAAGTCAACGGACTGCGTACTATTATGTTGTGGTCGTCCACACGCTCG
CTGCAAGCGGCGTCAGGCGGAAACCTCGTGGCCGAAACCGCGCGCGTGGTGGCGGCGTTCTCCTCGCTGCTCTCCATGCCGCATGAACACGTGCGCTCTA
CACGAATGTGACCATACGACTGGTTGTACCAGCTTCGTCTGATGCGATCTACTTTGAGAGGTTATTTAATGCCAGTAGTGCCTGAAGACAGAGGATAGAC
AACGCATTGACTCTCTCACGAACATCAGTATCCAAGCGATTGTGACCGCTTGAAGCGAAGCGAAACACGCTCGTAGGCAAGGCAAAGCAGAATTTTTCAT
CACGTATATTTGTTGTTCTCATAGCGAAAGAAAGAGAGATGCGTTGTGGTTACTGTAGCTGCTTCACTTCACATCCACGCACGCGCGCGGAAGTGCAAGG
CGATTATTGCGTCGCAATCTATTGGTCCTTCTTGCTCTCCGCGTCTTCTTCCTCATCTTCACTATCACTCGAATCCGCAGCGTTCATGACCTGTTCGAAG
AGCGTCGGCTCGTTATCTAATTCCAAATCTTCTGGGTGGGGCTGGTACACTGGGAGCAGCGCCGCTGGTGTCACCGTAAACTACAAGAATGGCAAAGAAG
TACAACAGTTAGCAACATGCGCACATCCGCAAATAGTAAGCGCAGCACAAAAAATAACAAAACAGCAGCACATACCTTAGCAAGCGCGCGCAAGTCCAAG
CCAATGTACGAGTCCGACTTGACGAAGATCTCCAACTGGTACGTGCCAGCCTTTGGAGGCGCCTGTAACTGCAGCTTCAACTCGGCCGTGCGTTCCTGCG
ATGTGATCTTTCCAAATGCGTGCAAGTGGTTGTTCTTCGTGTCGCCCACGATGCAGAACCAGCGCTCGACCTTTGGATATGGGAAGTGTGGCGCGTACAC
CAAGTCGCACGTGTCGCCTTCCTTGACGTTCTTGCGCGTCATGCTGATCGTGACCGTCATGATGTCACCCTCGGCGATCTCCTCTTCGTCGTCGACCGCG
ATTGTGATGTTGAGCTCCACGTTCGGCATCATTTCCAGCACCTTGTTGACTTCAGCCTTCTGTTCGTCGTTCAAGTCGTTCAAGCCCTTGCGGTCTTTCG
GGTCCATATCGACGTACTGATGCATGCTGCGCACAGCGTTCTTGCCCGTGAGGATATGGCGCACTTCGTTCTCCGTGAAGTGCGGCAATTGCATGAATGG
CGCGTCCTTAAAGAACAACGCCTGCGTGAGGAATTGCTCCATTTCAATCAAGTTCAGCGTCGTCTGCAGCCACGACTTGCCGACCGAGATCTCGAGCATG
CCGTCCACCAATTGGATCGCCTTCTTCAACATCGCGTGCAAGTCACCCGTCAACGCTGGGCTCAGCTTTTCACGCAAGAAGTGCGCGTGGATGAGGATGT
TCGCCTTGGCAATCGATGGGTGGTTGTACTTTGGCTTCGAGATCAAATCCTGATGCTTAAACACGCGGAACCACCAACCCCCCCCCGCCCCCCGCCCGCC
CGCTGGCCCCTCGTCCCCGCCGACGCCACACGAGGGAAAGAAAGCGACCTACCCGACGGCGCAAACCACAGAGAAACTATGAGACCTCGTCGCGTACGGC
TTCCAGTCTCTTGCAGAGAAAAGGATGGAAAGGGAAGCGCACAATATTCGATGAGGTACCATCTGCATTGGCCAAGACGACGTGACGGATCTACGCGTTC
NNNNNNNNNNNNNNNNNNNNCTTTGGGATCTCACGGAATTCCGCCGAGCCGGCAAGCACTTCTGGCAGCATGCGTGGGTGCGCGTGCTCCGACATCGCAA
AGTTGTAGAATCCGTACGTGTCGTACATGATCATGCTGTCACCATACTTCTTCGAGTGCGAGTACCAGAGCGCCACGCACGATGGGATCGCAATGACCAA
AATGATCAAGTACAAGAAGAGCACAATGTTGTGGTTCGCAGGGTCCAACAGGAACGTCGGTAGACCAATGGACAGTTGCAGCGCCTGACGACCATCCGGG
TTGCCAAATTTCTCGTAGTTGGCCTTGGCAACTTCATCCGTCAGCGCTTCGTACGCCTTGGCAACGAGCATAAACTTCTGTTCAGCGACGGCATCGCCAA
TGTTCTTGTCTGGGTGGTAAATCAGACTCATCTTGCGGTAGGCGCGCTTGATCTCGCGCTCCGAGGCGCCAGCTGCGATGCCTAGGATCGCAAACGGGTC
AAACGACTTGATCTCCGAGTCGTCCTTGAGCAAGATGGCCATCTGGTAGAGTCCGTACCAGAGGCCCGCGAGCACGACGAGGTTGAGCACAAAGAGCGGC
GAGAACACGTTCGAGAACTTGGTCTTCTCGGCCTGCAGTTGCTTCATCTTGCGCAGCTCGCGGTCGCAGCGGATGTTCTGGCGGTCGATGAGGCGGTCCT
TGAGGAACACACCGTACACGATGCGGCGCAGCGACAGGTACGTGGCTGGCACCACATAGAGCACGCCGAGCGAGATGGAAAAGTAGTAGAACGCCGAGTT
GTCGTACTCGAGCATGGTTCAAGCGGGAGCTTCTTGCTTGCGCTTGCCGCCGATTTTGAAGACTGCGGAAAGAGCCACGGCGCCGCTCGTGCGCCCAAGA
CAGCAAGCCACGTGGAGGCAGGCACCCCCAGCAAAGGAAAAACCTCAATCTTCCCTCAAGTGGAAACTGTGCAGCGAGAGAACGGGAGACAGGGTTGCTG
GATGAGGGGAGGAGTTGACGTTTTTGGCTTTGCTCCAGCAGTCGAACCGGATGGGACAAGGAGAGAGGATTAGCTCATGTGGTGAAGTATGCGCATGTAC
TCATAGTATGGATGGATGCGCTGGTGTGGCGTTCTATCTGTGGGAGTGTATCGAGTGCTGTATGCACGTTGCGGTGACACTTTTGGAAACAGCACGTGAT
CCGTGACGAAAACAGCATGCGGCAATCGGCGGGTACGAATCAACCGGATGCAGCTCACTTTGTATACTTGCTGCTGGTATAACTTTTAGGAGCATTCTCC
ACTCGATAAACCTCTGTGTATACCTTCTTAAATTGCATTCAATGGTGTGGTAGACACCACTACTCATTATACCAGGTAGAAATAGCGAACTTTATAAGAT
GTATCACAGTACGCTATTTAGAAATGCCATTTAGAAACAGCGTTACTTTGCTTTACTTTTGGCCTTCCACCAACAGCTACAAGCAAGCAATATTGGAGCA
ATATTGGAGTAGCATGGGCAAGAAAAAGCGTCGCGACGACGGCGCCGAGGGCGGCAGCAGTGCGGGCGGCGGCGCGCAGACGTCGGCCTCCAAGAACCGC
ATCTTCTGCTACTACTGCGACCGCACCTTTGAGGACGAGAAAGTACTGATCCTGCACCAGAAGGCGCGCCATTTCAAGTGCCACGTCTGCCACAAGAAGC
TCAGCACCGCTGGCGGTATGGCCGTCCACGTGCTGCAGGTACATAAAGAAACGATCTCGACCGTGCCGAATGCGAAACCCGGGCGGGAGACGGTCGATAT
CGAGATTTACGGCATGGAAGGTGTCCCGGTCGAAGGCAGCACAGCAGGTGCGTGCTAATTTGTATCTTGTGGCATATTATGTGGACTTTGATGCACGACT
ACGTTCTTGTTGTATTTTGGCGCGTTATGCGTGTACTGACATGGTTGTCGCTTTGTGCACTGAATATGTATAGATTTTAAAAAACCGCGATTGGATGGAG
TGCCTCTGCCGTCGGGCATGATGGGAGGGGTAGGATTTCCGCCACGAGGGATGCCGCCGGGGTTTCCTGCTCGTCCGCCACCACCACCGCCACATCTGCA
GCAGCCTGGTATGATGGGGATACGACCGCCGCCTCCACTTGCAGGCATGCCACCTCCAACCGCAGGCATGCCGTTCCGACCACCACCGCCACGTCCATTC
CCAGGCGGACCGATGGTTCCGCCTCCACGGGGGATGGCGATGCCAGGATTTCCGCCACAGATTCCAGGCGCACCGCATGTTCAGCCTCCGTACGTGATCC
TTTGGCTTATGGCTGCATTATCTGCGTACTTACCTAAGCATTATGTATTTGGTTACGTTGCTTCCGTGTAGGTATGGAGTTCCTCCGCCTTGGATAGCCG
CGGCGGCGCCGAATGGCGTGGTTCCTCCTGGGCCGCGACCAGGAATGATTCCTCCTGGCGCAGGTGCTCTCCAGACAGCAATTCCACCACATTTGAACCC
GCAAATGGCAGTCGCTGCTCCAGTTGTGGGAGCGCCAATTGGTACGAGTTTCTCACAACCAGATCCAACACCAGCTTTGGCGCTGACCAACCCAGAGGAC
CCAACAGCCCACAAGAAACTCTCAGACTTGGGTCTGGTGTACCAGGACGATCTCATTTCGATGGTACGTGTCAAATGCAAAGCTTTTGAAAGAATCCCAT
TTGTTTATTATAAGATGCTAACGACGCTTATAAATGCTCTATGATGCTAAGGAGGAGAAGCGAGCACTGCGACCCAATTACCGGTACAAGCCTGCGCAAG
CACACATAGTCCCGACGACAGACTGAAGTAGGGTCATTTGAGAACCAACCTGAGCAATGGTGTGTTTGATCAAAAGTACAGAGTTCTTGCTTACTGGCTT
CTGCATGCGAGTCTGTCTGTCTGCTTTCGGTGGATTACATATCCGTGTGTGTTGGGTGTATTCGTTTCATTTGTGTGCAGGGTGATTGCTGGTGTGGAGT
TGCTCGCTCGCTAGACCTGGCTGAAGTCTTGCCTATGAGTCCGGGTACCCGCCGTATTTCGAGCAGTAGCTCTTGAAAGGTTCTGAAACGGGGCTTGGCG
ACGGATCGGTTGAATTGTTGCTGTTGGGGGCCGCGTCGTCCGTTGTACGTGACACTGCTGGTTCTTGGGTTGAGTTGACCCTGTCCACTTTTGCGTGGCT
CCAATTTGGCAGCGCTACTTGCTGACTCTCTGAGTAGTTGTTATTGCGAGGGCTCTCGTACAGCGATGTCAAAACTGACGACGGCGTCGCGGACGACTGG
AATGCTGCGAGATTGAACGAGCGTCGCGGGCCGCTGTATCCGTTATCGTCGCGGTTCCTTCTCCCAAGCGAGCTGCTGCTGCCACTGCTACCTCGTCGGG
TTTGCAGGAGGCTAGCAGTTAAAGAATCTTCGTTATTCCTCGGTGAGCTTCGCGGAGCCATTGGGGACGAGACTGGACTGACGAGATCCGGTCCCAGTTT
GCTGTGAACAGCTGCCGCTGAAGGTGAGTCGTAAATCCTCAAGAACACGTTAGACGGCGAGGACACGGTATCTTGATGCTCATCATGGGTCGGACTCACC
ACATGCGGACAGGAACCAATCGTGTCATCGTTGTGGTGGCTTTTCAGGAACGATCGACGCATGAGTCGGATTCGAGTCTGTGCTATCTGGTAGGGCTCGC
GGCGTCCTTGCTTGCCGGCTTCACTGTTCAGATCCACGAAAATGCCTGTCAGGCTCATGACGAGCACCAGACTCGGCATCGTCATCGGAGTGATGACACA
GAGCGCGAGGAGCGGCAACAACACCATGATCGGCAGAAGATAGGCTCCTCGATCCGTTTGCATGATCGTTGGCGCTTCGACAAGAGAGAGCCACACCAGG
TAGAACGCTTGGCTGATCGTCGCGAACTGAAACAGCCGAAGCAAAAACTGCGGGCTGTTGAACCAAAAGCGGTCATCATGATGATGCAGTTGCCGATGGC
AAAGCGCTGACATCTGCATGCGGATCATGGCACGTACTCCCAGCGCCACGCCTTTCAGTGACAGGCGCTTTGGAGTCTGCAAAGGGGCTTCGAGTTCGTT
TAATGAGAGGTTACTGTTGTCACTGCTCTGGAGCTTTGTTAGCCGCATTCGGATATCTCGCATCGTGATCACGCGAAGGCGGTCGTCCACGATGCCGCGT
AAGATTTGCAGCACCTTGAAGAAAATCACCAGGTTCACGAGGAGCAGGATCCCGCCAACGCCGATAAAGATCCAGTGGTCGTAGTTCGGGTACACTGACG
GCAGCACAGAGATCACCACGAGGATAAATAGTGCACTGACATGCAAATCCGTGATATGGAAGAGCAAGTTGCGCATGCAGAGCATGTGGTACCGGGCGTA
CGTCATGGGCTCGACTTCATGCTCCTGTGGGAGCAGCCACCTGCTTGGATTGCTTGGTGGAGGCTTCACGCCAAACAGTCGTTCCATCTCGGCTGGGTTC
TTGTAAATGTACCCGGATCGATTCTGGCAAATGTTGTACGCCAGGATCTCAAAGCTTTTCCACAGATGCCACTGCTTGAGCGCGTTGAACCGGAAGCACC
AACCTTCGCGCTGGTAGCGCTCCAACAGGAGACTATATGCTCGCGATCCCTGGACCAGATCCATTCCTGACTTCATTCGTCGCAGCGTCGACGGTCGATT
TCCATGCAGTCTGGAGGTCGACTGGAACTCGCCACGCGTCCACCGATCCTCCGATCCGTTGAGTGTGCGGTTGTAATCCGCATTCTCTTCTTCGTCACTG
TACTGCAAACCAAACGCATGCTCGCTTTCTTCTTCGAAGTCTTGGGAACTGTGCTTGCTCCAGATCAGTTTCGGGACGACCGTGCCGATGAAGAGCAGCA
GCAGCACGATTATAATAAAGTAAATCATGGTCAGGAACACGATGTAGTGGAAGAATTCATAAAAGTGGAGCTGCTCGGACGCCGAGAGTTTGTCCACCGT
AAAGTTCATGTTCCTCATCGCGCCGCTTGTGTTGAGCGTGAAGATCACCATCGAGATAAAGCCCATGATCATCACTTCCTGGAGGATGCGGTTCACGATC
TTACTCAGCTGTGGGCAGTGGATGCCGTGGCGCACGTAGTGGATGAGGCGGTCAAAGCAAATGGAGATGACGACGATGATGCCGAGCAGGAACACTGCCG
TCCCAATGTTTTCATGCAGGCATCGCGTGTTGCCCACGCCAAGAAACGAACTGGACTCGTGACAAAAGCCTCCCGACACACTCGTAGCCTCTTCAACACC
TGCCAGTTGTCGCTGCATTGGATTATCTGAGTGTGCATCGATATCAACTCCTCCACGTAACTGTCGCTGAGCTTGAAGATTTGTCATCAGTACGTCGTCG
TTCTTCATATCGGGCTGCAGGTCTTGAACACTGACATCTGCGCTTGTGACGCCGCCCACTAGCGCCATTGCTACGACGCTCGTGATGATTACGACGCTCC
AACGCGAACAATGCAGACGGGATCGCTTCTGCCGCGACATCACTGACGCAGCGCCGTTATAAAACGCGCATCGTAGTCCACTGGGAGCGGAAGCGCCCAA
CGATTCCTGCTGACACACAAATATCATGCAGTAGGACAGTTGCAATCTGCGAATGCTGCTTCAAACGCCCGCTTCGTGCGCCACCTCCGACAAAGACAAG
CGCTTCCTCCTTCTCGTCTTTTCGTCTTCTCGTCTTCTCTCGTTCGGGATTATTCACGGCGCCGCTGGCTGCCTATCTGCCGTCGTCGTTCCAGTGAACC
ACCTGCTGCCACCGCATGCCCATATCTGAACGTAGCTCTTCAGGATTGGATTGGAATTCGCCCAACGACCATGCGATATGCCCATAGTGATTACACTTTT
GTATTGGCTGAAATTTTCTATAAATTTTATGGTAGCCAATCAAATGGAGAGAGAGCAGGAAACGTTGAAGTCCCATACTGAAACGAAAAGATCTATTTTT
GGTGTAACGCAATGTTTTTCACCAATCAGAGCGCGCGAAAGCAAACGTCGCGTGAAGAAAATGAATCTCGGACGCCATGCCCAGTTTCGCCGCGCAGCAA
TTATGCGGTCGCCCGTTATTGTTATTGGGAGCTCTATGAGCATGGGATGTGAGCGACACGAACGGGTCTGGACCCACTCTGTTAGTTCGCGCACATGTGT
TCATTCATTCGCTCGACCCGCTTGTATGATAAGCGGCCCTTTTTGCTCTAGTGAGAGTTACTTTGCAATGCGCTGGCGCGAAACGTCGCTTCACGATACG
ACCTTTCCTGACTGAGGTCATGCGGTGGTCGTCTGGTCTTTTACTACAAAGGCAAAGGACAGCAGACGCTGACGTAGTTTGTCGAGGGCATTGAGTGGCC
GCCATGAAGCTTCGCGGCGCGTGCATGAGCGTTCTGCTGTTTGGTCTCGTCGCTGCGGTGGCAGCAGTCGGTGAAGATGGCGACGCGGGACCATTTCGAA
GTGAGCGCTCTACTATGGCAGCAGCAGCAGCACCAATACAGTTGGTCAATGCGATCTCCGCAGTCGATGCAGTGGAGACGACGGCGCAGGACGAAGGACA
GCGCGCTCTTTTGGATCAAGAAACTGCGGCTCCAAAAGCAGAGAACGGGATCAATGAAGAGCCGAAAGCAGCAGCCAGCGCGCTGGAAGTGACGCAGACG
ACGACAGCACAAGAGCAACCGCAGCAGCAGGAGAAAGAAGAAGATGCAGCAACGCTGGTGGTGTCGAATGCGACGGCAACGAATCAGCGGCCTGCGGTAG
GCTCGGGCATCGTGGGTCTGGAAATAGCCGCGATCCTCGTGGCGTCGGCGACGGTGGTGACAATGGTGGTCAAGCGAGTGCTGTCTGCCAAGAAGCGCAA
TGAAGGTACATACACACAAATGCTACAGTCCGCATTATGTTTTTTTGTCGTCATACTAATGATTTTATGTTTGCTTCTAATCTCTGTGCAGAAATCAAAA
ACCAAATGCTGATGCAAGACCTGCTGTACAGCGACATGGACTACGCGGCAATGTAGCAGCATCTTTGTTCGCATATAGGTTTCGCACGCAGACACACACA
TGTTGTGCGTTTGCAATATAAATATATGGATTCGTTTCTCCACCATGAGTACGGATACGAATGAATAGGAGCCATTACTCGAATCCAAATGTTGCGCGTG
CGTTTTGCTGCACTTGAGCTGCTAGTTCCTCTAGCGACACATTCCGAATCTCCGCAGCGCGAATGTACGCGATTCTCACAAACGCAGGCTCGTTCAGCTG
CAACGTTGTTGCCACCAACGAGTCCTCGGCAGAAAACGCTATGGCGTCGTCTGCATCTGCGTGCTGCTGGAGCACCTCGGGTGGCAATACTTGATCTGGC
GCATCTGTCTCCAGCAGCAGCGATCTCAGTGGGATGCTCGCACAACACGACGCCGCCTTGTCCGATCGCGTATCCGTGAGCTGCTTTGCATTTAACGAGA
AATAGACTTGTGTGTGTGGTGTGACTTTCTCTTCGAGCGCGAGGAACGAGGTCGCCATCTCGGCACCTCCGCCATACGAGTGCAGCACGATCTTCGGCGG
CAGTTTGTGCGTCGCTTTGGTCTGTTTCTGAAGGAGCTCCAGCAGCTTCCCATACAACCCGACACAATGGATCACACATGTCCGCGAGAGTTCCGCGGCC
AGCCCCAGTTGCTCGTAAAACACGCGCTCCTGGGTCTCGCGATCCACGAGCCGACCACGTGCGGTTTTACACAAGCCGATCTCGCCCAGCTAATACATAT
AGCATACATGCATAGCGTTACTATCGATTGCAACTTTGACAATTAGAAGCACTTTGAGGCATTTGGCTTACACTCGCGTTCGGATGTTGCATCAGCTTGG
CGCGGAGGAGCTCCAGATAATCATCGCGTTTCGATTGCGCCCACCACGGATGGACGCCAAACGAGGGTGTGAGCCCAATCACGCCACTGCTGTCACTGCT
TTTATATTGCTCCCATGTCGACAGAACGGTGTCGAGGGCGTCCCAATCGTCCTCAAAGCATGCGCACGACACCATGTGCGTCACATTTGCCGCCGTTGCG
CGCGCGATCACTGCCTGCAGAGCGCCTCCTTCCTGTTGCTGACTGAACCTTGGGTCGTGGATGTGGCAGTGCGCGTCAATAAATGCGGGTGCTGACGCGC
GCGCCTCTGGGGATGCCGAAAGTTGGGTCATTAGGAATCGACGCTGCACGTTCGCCCCAATGCTCTTCCTCATGTGGAAGTCGAATTTTGGTTTCGTCGT
AAAGTTCGATTGGACAGAGTCGGTTAAGTAGAGTGCGAACTTCGCGTTTTAGCTGATCCTCTTGAGTTGCATACTTCTTGGGGTGTATTTGTCCCACCCA
CCAGAAGCCAGTCATGCCCAAAGTATTTGTGCCTATGCAGCGTGCGTCACGCCCAGCTGACCACTTGTCGCAGAAAGTGCTTGAAAAAAAAAGAAATATA
AAGCGAATCACCCACAATACCACTTTTGTGGCATTTGTACCACTCAATACAACCCGCGCATGCCCCTCTTGTACCGTCTAACTGTGAATAGTGCCCCCTC
CAGCTGGTAAGTTTCCTGAGTGGAACATGGAAATAAAGGAATGCCCCGCGTGCGCATAAAGCAGCAGCGCATCCTCCTCCGTCGCCCTTCTCTTCATACA
CAGCAGACAGCTGACAGCAGCAGGACCCAGTCAGCTACAGTACCGTTGCCCTCTGTGCGTGTGAAGAATACCACGCAGCAGCAGCATATCGGAACCCGCG
CCAGTCTCCGCTATTACAATACCACACGATTTGTCCCAGTGCGCCAAGCATTTACGTGTGCATGCCCGCCTCGCGCATCGACAGTCACTAGCAGACGCGT
ACGTATATTATATACAGGTTTATCATGGAGTCGCCTCCGCGGTTGGGTCTGCCGGACGACGCCTCGAACTCGCCGACGCCGAACACGAGCTTCTGTCTGC
TGGAAGCGCGCGACTCGCACAACGACATCGTCGTGCCCGTGGCGAACGACGACGGCGCTCCAGCAACGCGCATGAATGCCCGACAGCGACAGCAGCCGCA
GTACCCGACGCGCCAGCCGCCGCCCGATCGGAGCGAGAACGACTCGCCGAGCTTCGTGTTCCAGCCGCAGCAGCTGAACCAGTTCCGCGGGACGAATGGG
CCGAATGCGCACGCGCCAGCGTACCGCCGCGAGCGCATGGACTCACTCTACGACCTCTTCCCGATGATCAACGCGAACGTGTTCACCAACCCGGAGAACA
TCATGCCGTCACACCAGGACGCGATCATGATCGACGATATCCACGACCACTTGGCCAGTTTCCACAGCACGAACAACAACACTCTCAACAACAACGGCAC
GCTGATGGCGCAGAACAGACTCAGCGCCAACCAATTGTCCATCGGCACGATCTTCGGCGGCCTGCGCACAGCCGCGAGCACGCGCGGCGGCGCCACGACT
GGTTCGGCGCGCGATCCGTCCTGCCAGTCCGCCTCGTTCAACGATGCGCGGCTGAGCAGCAGCTCGCACGACTCGCTCAGCGACACGCTGCGCACGAACG
CGTCATTCACGTTCCGCAGGACGCCCAAGCAGTGGCTGCTCTCGCTCTGGAAGCGATTCAACATCAACTGGGACTCGTACTTTTTGCTGTTCACACTGGG
AATCTCCATCGCTGCGATCCCCGTCGGCGTCGTGGTCGCCACCGTGGTAGATCACGCGCGCCCGTACAAGAACTACAAGCTGCGCTGCAAACGGGCGATG
CCCGTCCGCGAAGACACGATTGCGTCCACGGCCGCCGTCACGATCCCGATGCTCAACTTGCTCGTGCTGCTGGTCATCTCGCTCTGGGTCGCGATCCGAT
GCAGTCAGAGCCGCAAGCGCGTGCTGCGAAGCACGGCTGCCACCAGCGCACGCATCAACCTGAGTACGTACACGCTGCTGCTTCACATATTGCAGTGTAT
TTGGGAAATGCCGATAGGTTAACGTGTGTTTTCTGTTTGTATCGTGAAAACTGTAGCGTCTGCGTTCATGCTGCCGTGTTACGAAGCCATTTGGTACATG
ATCGCGTTCCTCTCGTGCTGCGGCATTGCGCTGTACGGCGTGAGCTATTCACCCATGGCGCTGAGTTATTCCGACGAAGCTGTCGCAGAAGTGTCCGACT
CGGTCCCAGAGAACGACGACGCGCTGTACCCGTGCACCATTGCCACACTGCCGTCCGTGTGGATCCTGCAGCTCTTGCCAATGCTCATGGTGCAGCGCAG
CGTGTCCCAAGAAGCCGTCGTGCGCTCGATCGTGTACTCTGGCGCCGTGTGTATCGTGATGCTGGTGCTGTACATGAGTCTGTTCACGCAGAATGGCGGC
GTGGCGATGAACGCGATCTCTGTTGCTGTACATTTCGTGCTGCTGTGCTTTTACTTTTGGGCGAAGTTCGTGTTCCACGCGCGGTCATCGTTTGATTTCT
TTTTCGTGGCGGCCGCGATCGGCACGACTTTGAACTTGGTAATCCATATCGCTGACATGGCGAGCGCGGGCGGGACCAATGGCATCTACATTGGGCACTG
CATCGTGCAATGCATTTTCTCGCTGACCACGGTGGCGATCCTGCTCTCATTGCGCGCCGACACGAGGTACTGGCTCGGCATTGACGACGGCACGTCGCGC
ACGCGGAGTCCGATGCGACAGTACATGCGTCAGCTTGCGGAGCGCGGCATGATCACGAATTTCTCCACGCGGACGTCCGTGTACGATGTTCACCGCATGA
TCGAAGATCACAGGAAGAACGTCGTGGATTTCTCCGAGCTGAACCTCGATGGCATCATTGCGCAGGGCGCGACATCGATCGTCATGCGCGGCGTTCTGCG
AGGGAACACCGACATCGCACTCAAGATTTACACGTCCGTCCAGGTTACCGACGAAGAACTGGATCGTTTTTCCCGAGAAACAGCGCTGAACGTGCAGCTT
TCGCACCCGAATATCGTCAAGTTCCACGGTCTTTGCGTTGTGCCGCCCTCGATCTCGCTCGTGTTTGAGTTTTGCGAGTACGGCGGACTCGATATCGCGC
TGCAAAACAGTCGCTTCTGGGGGCTCTCGACGAAACTCAAGGCGTGGCTCGATGCGTGCAAGGCCGTCGCGTATCTGCACAGCTTTTCGCCGCCGTTGCT
GCATCGCGACATCAAGACCGACAATTTCCTACTGGGCCAAGATTATCTGCTCAAGCTGGCGGATTTCGGCGAAGCAAACTTGTTGCGACCACGCACGGAC
GGCACGATGACGATCGCCGGGACGGTGGATTACATGGCGCCAGAGATGATCCTCGGTGGGAAAACGGCGCGATATGGGACTGCCGTGGACACCTACAGTC
TGATGATCACGCTCTGGCAGATCATGGTGCCCGACCGGAGCCCGTGGGAAGGGAAGACGCATCTTGAGGTATATACGTGTGTCAAGGACGGCGAGCGGCC
GCCGCTGCTGCCGAGCATCCCGCAGGGGTGCGCCGAGATCCTCGAGAGCGGCTGGTGCGCGAACCCGTTCGAACGCGTGGCGGTCGATGAACTCATCCCG
AAGGTTCACAAACTGTGGCTGCTCTCGCTCCATCAGAAAGTACTTAAGCGCACAAAGTGAGAACCAATTTTATTATGTTCCTGTTTTTTTAGCTGTTGCC
TGGAAACACGCACCCAGTAATTATTTAAGTCGATTGGGAATAAATAACATACATCCGTCGTTTGCGAGTGCATCGCTGGTGCTTTGACTACTTACATAAT
GGACATGGGCTGAATTGCGCTCGCTTACAATTCGGTGAGGGTGCTTGGGGCCTCCTTGCGCTCGTCGTCGTCGTTGTCGGTGCTGCCGTGCTTATGTTTG
TGCTTTCGGGAGGAGCTCTTTTTCCGACTTGAAGACCCAGACGCCTCGGAGACATCTTTCGACTTGTCTTTCTTTTTTTTCTTCTTCTCGGCCTTCTCGG
CGTTAAGGTTGTTGCTGCTCGACACGCTTGTCAGCAATTGGTGTCTGGATCCCTGCTTCTTCAGCAGCTTGTCTCGTTGCGCTTGACGCTGCTTCAGCTG
GAGCTTCTTTCGTCGTTCCTTATCCTGCTCTTGCATCTGTTGCCAAGCCGCATCGACTTCAGGATGCGGTTCTCCAAGTGCTGGTAGCTGCTGGTCCAAT
AGCAGCGGTTCCGGCGATTCCGACGTCGCTACAGCATCGTTTGCATTTACACTTGCTTCGTGCTGAAGCTGTTCACCGATGGCGGTGGAGGAAACCTGGT
TGGAGGATGGAGCATACTTTCCGAGGAAAAGACTCTCTTCTGGGTCGCTCATCGATTTGTTTCTCGACACGATCGTCTCAATAGATGGGGTCACACTCCG
ACTTACGCGCTTCTTTGACTGCACTTCAAAGCTAAACATCTCGGACTGATCGTCGTTCACATCGTCATCCAAATCTTCGTCCTCTTCGCTCTCGTCTCCA
GCCAGGGAAGTTGAACCAAGCGCCATACTGTATGGATCATTCGACTGATCAAACAAGCCGAAAGAATCGTCACCCACGCTATGTCGATGTTTTTCGCGCG
TCGATGTGGAATTCTCGCGAGTATTCTGAGTAAGAGCTTCGCTTGAATGACGTGATGTCTCAATAGACAACACCTCAGCACGAGTTTCGCGTAAAATATG
ATTTGTTGCCTCAAAGATCAACTCCTCAGACCGATCATTTCGTGTTGATTCTCGATCGGCATCAAAGCTATCCATGCTCAACGGAATAGCAGCTGATTCA
CTAGTGACAGACGAACTCAACTTCGAACTTTCCTGTTCCTGTGTTGCTGAAGCTGGCGTGCCCACGTTTGTCACAGATGGAGCAGCTTCACTTGAAACTG
CATCGGCATCTGGAGCTACTTTCAATTCAATAGTCACTGTGGCTGCAGCTGAATCAAAAACGTCAAACAATGAGCTGTTGCGGGTCGTCAAAGAAACAGA
GTCCACAGAAACCGAGTCGACAGAGTCGACCACTTCAGTCACGACGTCGAGATGAGGTTGAGCCGTCTCATTTGAAATGTCTTGCTGTTCTGGCGCATCC
AGAAGAAACGACACGCTTTTAACTCGACGATGTTCTGGCTTCTTCAGACTCGGCGCAAATTCTTCATCAGAGTCTACCAACTTGTCGTTGCTCTGGGTTG
TGCTCTGAAGCAGACCCTGAGAACTGGACACCGCTTGATCAGTTTGCTGTGATCCTCGTTTCGCAGGGCTTGCTGCTGCTCTTCGATTCTTCAAGCTCAG
GGCAAACTCCTCGTCCGAGTCAGCGTCACTGTTTGTTTCCTTAATGTCAGCTTCCTGAGTAGAGCTTTGTGAAGGCGTAACAGGTGTTGACTTGAAAGAC
CCACGTTGAGAGCGTCCAGACTTGGCGTTTGCCAAACTGAGTGCAAACTCTTCATCTGAATCCTCATCGCTCATTGTTGCATTTTCCACGACAACTTCTT
CTTGCTTTGCAACATCCCGCTGTTTCGAGTCCGCCTGCTTTTGACTGACCTTATCATCGCTCTCACTCTCACTCTCACCCGCTGCATCAGAGAGATGATT
CGCCTTTGAGGTTTTGCTCTCATCTTGCTCGAAAAAGTTCATCACGTCACGTTCATCAGAGACATCAAAGAGCGCATCAATTGAATCGACAATAGCTGGT
TTCAGTGTCTTCTTTTTCTTTGGCTGTTTGACTTCCTTTGTGGCGACGCTCTTGGATATGACGGTGGCAATCGATGATGACTTCTTCGACCTTTTCTCTT
CTTCAGAATCACTTGAAGAAGCTGCTGCGACTGTAGTTACAGCATTCTTCTTCCGTTGAGATGCCGTACGAGTCTTGCTTCGATTCTTCAGCGACGGGAA
GTCTTCTTCATCGCTCAACTCATCATACTTGACTGTTTTCGTAGGTGCCTTCGCTGTAATGGCTATNNNNNNNNNNNNNNNNNNNNCCCCTGTGTGCCTT
GCCTATCCCCTGTTGCGTGTCTCAGTTCGCTGTAATGGCTATAGAAACAGCGCTTTTGCTCTTTGTGCCTCGGCGGCCTTCTTCTTTAGCGTCCTCCTCC
TCATCGCTACTACCTTGCGCTGGATCGGATCCAGTTTGGAAGAGCGCCTCATAACCTTTTCCACCAGCGAGATTGGAACTTTCAACTGGACTATCTTCAA
AAAGGTCAGCAAATGAATCGCGACGTTTCGCACTCTTCTTCGCAGTTTTTTCTTTGCGGGTTTCTTGCGGACAATTTCTTCCTCATCGCTGCTATTGGTG
TCGAAAATGCTCATCTTCCGAGGGCCTTGGACGGTTGTGTTGCTTCGCGCTACTGCAGTAGAAGAACGAGCCGCAACGTGCGAGTTCCGACTGCCGCTTG
GTGGGTGCTCGTGGTCTTTCCGCTTTCGAATCAGCTGTTTCAGCGCAGCAAGTTCACCTTCCAGTGACGAGATCTTGTCCACGATAGTTTCGTCAAGTTC
ATCGTCCTCATCACCACCAGCTTCACCCTGAACCGTTTCTTGTTTCCTTCGCTGCGGTTGATCGTATCGTGCAGGCTGTTCGTATCGCTCAAGCTGCTCA
TATCGACTATTTTGGAGTTCGTGGATATGCATCACCGGCGATCTTTGCTCTTGGGCAGGCATCGATGCGTAATTGGTCTCGCTTCGATGAGCCACAGGTT
CTTTAGCCCGCTTCGGAGCCGAAGCAGAGACGTATCCTCCTGTCACGGAGTCAAAGACATAATCATTCGGTCGCTCAAACTCAGCAAGGAAATCGTCCAG
GGAGTTGGTTTCTCGAGATGGGTGTATCACACTGGAAGGCTGATGGTGTAAATCCTCCATAATACTATGACTTGCTGTAGGTTGGCTGACTCCACGCTCG
TCATATCTTGGGTTGCTGCCTCGCGCAAAACGATCGCTGGATATGCTCGATGGGATAGCGTAGGTCGCGACACCAAAGGTAGGTTCGGCGCGCACAGCGT
TCCACGTGTTTCCAGCTGGCCGGTTGGATTCATGATTCATCTGCTCGTTCACAAAGCGACTTTCGCCGAGCCCAATCGACGACGCCCGTCCACGGTCTAG
TATTGGCCTTTCAGTCAAGCGCGACGTCGGTACATTTTGCGGCACATCGCTGTCGCGCCGGCGGTCAAAGCGACTGACTCCCGTAGTCGGTATCGCAGAA
GTGGAGCTCGTCGCAACGCTGTCCCATGCTCGCGTTGGTAAAGTGTGGCGTCCTCCGTCGGACACAGCAGCGTTTTTTCCATGGCTATCTGGAGACTCGA
ACAAATCATCAAACGTATCACGTCGCTTTTTCTGAGAGACATCTCTGGTGGAGGTCGATGAGGAAAACATAGACACTCCTCTTGTCGTCGTGGCAGTGAT
GACGGTGTCCGATCGCGGTGGAAAATCAGTTGTCGGGTTGGAATACTCGGCGATAGTGTACCTGCTTACATCCAGCTGATGATTGGCGTCACTCCCGAGG
TAAGAGCGCTCAACCATGGAGAAGCGATTGAACGATGTCCCTCTTTGCAAAACGTTCGACTCTCGGGACGACGGCTGCGGGTCATACATTACCATCTGCG
AGTTGTTGTCCTCGGCCACGATTGCTGACGTACTGGAGGACGCTGCTTCAACTTCGGTCGGTGGCACGACAGGGGGTGCCTTCTGTGATGATTCTGTATG
CTTGTCGGTTGATTTTGATGCGGAAATGCCGAAGAAACGCTTAAACACACCAGTTAAACCGCTTCCACTTTTTTCCTGGGGTGAAGAGGAAGCCACTGGC
ATTTTGGTTTCAGTGGAGTCTTGTGTCGTTGCAGGAGAACCGTTCGGAGTAGGAGTTTCGACAATGCTGTACGAGTCTGCGTCGCTCAGTATGGCGCGAG
GCTCGACCGATTTTGGCAATGGCGCGCTTGCCCATCGAGAGTAGTCAGTATCTCTTTGCTGTGGTTCCACTGGTGAGGATCTGTAGGCTTGCGAATTTGT
GCGATCAAAGTATCCTGGCGTATCGTCGACAACCAAGTCATCAGCGTTCGCGTCGTAAAAGGTTGGTCGAGCCTGGGAGTTCACTACTGGTTGGGGAGGA
GCATAAGGCTTTTCAGCAGCGCCGTTACGATCAGATGTACTTTGCGGCTGTGCGCTGCTGCTCTTAATTTGAGGTTCACTGTTGCGCTTGTCTTTCTTCT
TGTCTTTCTTCTTGTGCCCGTCTTTCTTACCGTGAATATGGAACATCCCCTTGAGATTTTCCTTGAGCGTCAAGCGACCTGGCGATTGGTCTTCTTCACT
GCCTCGTTCATCATGTGCGGCCGCATGCTGCACAACCACAGGCACTTTTTCTTCATGGCGCGTATCTGCTTTGACGATAGCATGCTGCTGATTTGGCCGA
GGCATTTCCATTCTCAATGGTCTGCCTGTATCATACTCGTCATCGCTTCGGGGTGCATAGGCATCAATGGAAAGCGAGTCTTGTCTCATCGCTTTCGGCA
TGCCCCCACGGGTCCCAGTAATCGTATGGCGACCGGACTCAGTGTGCCATTCATTAGGGCGAGGCATTTCCATTCGAAGTGGCTTACCTGTATCATATTC
GTCATCACTCCGAGACGCGTATGCATCGATAGAAAGGGAATCTTGTCTCGTCGTCTTTGGCATGCTTCCGCGGCTCCCCGCGATCGTATGGCGGCTGAGC
TCCGCATGCCATTCGTCGGCAGCTGTGCCTAACTTGGGTTGCGCCAAAGAGTACCGCTGGTTCTCGTTGCGTTTCCTTGAATCGAAGTTGGAATCATCGT
CATCAAAGTCAAACAGATTCTGCTTCTTTGACGCCGCGTTTCGGGCTTCACCTTCATGTGGATCAGTGAACCACGTATCGTCCGCGACATCAAACAGGTC
ACTGGATTGTTTCCTCTCCTCGAGAGGTCGGTGCACAGGCATCTGAACGCCTTCACGAACGTTGCTCTCGCTACTGGCAGCAACATTGCTTATGTCCTCG
TTCGCTCTCCGTCGCTCATCGCCGCTTTTCTTAGTGTGCTTTGGTGTGAAGGTCTTTTTAAGACTCGCACGAAACTTGCCGCGTTTCTTCCCCGAGCTGC
TAGACGGAGTTGCATTGAAGCTGCCATCCTCGTCTAGTTCGTCGTCCGTCACGACAGATCGATTATAAGAAGCCTCATCGTCGATTTCTCGGCCATCGAG
ACGGTTCCGCTGCGCCAGGTCACTGTTACATGAAGAGCACACGCGATGTTTCTTGTGCGAGACCTCGAAATACCGAAATGTCGAGCAGTCAGAGCACATT
ACACGCCCACAATGTCTTTTCACAAGAGATCACAAACAGTAAGTTTATGCATAAAAATATGCATGGCACCGATCACAGTGAAACCTTACCGGCAATGGTG
CTTTCGCTTCATGAGGGAAAACCCGCTCGAGCACACGACGCACGCCTTCACGCGGCTGTCGTCCTCCCAGTCGACATCAAAGAGCTCTTCGCTGCCTTTG
CGGCGCGCCTTCCTTGCGTTTCTGCCACCACCGGCGCCGCCATCGCTCTGCTCGCGTCGATTTCTCGGTTTACTCATCGAGTTTCTTCCTGGAGTTGTCG
CAGAAGAAAGTCGAGCGCGGCCGCCGGTGTCGGACCGGGAGTACGTCGTGCTCGGGACGCTCGACGCGGGGCTCACTGGGTAGCTATACACGCCGTGGTC
CTCCATGCTGCTGCGCGTAGGCGGCGGCTGTGCGCTGGAAGTGGGCGGAGGGTACGGGCCGCCGCTGCTTGCGTTTGTCGGCGCTGGTTCCGTGTGCTTG
ACGGCCGGATGGCCGTACAGATCGTCAAAGTCGCCGTCGTCGTCCTGCCACAGATCGAGTGGACAGACGCGTGGGCGCGTATGTATAGACAAAGAGTCTG
TTAGTAAGCCACATAGACGACATATACAGAGACGCACATACAGAGAGACACGCACCTCGTCAAAGAACGGGTCCGCCATATTTCTTTCTGAATATTCTCG
TCTCTCTTTTCTATTTGAAGTGTCTATAGGAACACAAATACTAGCGACTTCGATCCAGATTACCAACACTGTGTTCCACCACACGTCTCACAATAGGGTT
CCACATATCGCTATACAATGTAATGTCAAGCGACCCATATATCATCCTACCTTGAAGTGTGAGATACAATTTGGGTCGCTCCACATTATTTCTTGATTCG
ATTTTGAAGACTCTGCAGAAAACGTGCGGGGCGATTGATATGCGTGCGCTGCGCATGAAGACGTACGGGACGGCGGCGTTCGACGAAGACCACGGCCACG
CCGTAGACGACGACGACCTGAAGGAGTGCAAGGACGAGTATGTGGACGACGCTCAGCGACAAGCAGGTGAGCGTGAGAAGCTGAGGCAGAAAAGGCAGAA
GAACACAGCAGTCCCGAGTCCACATGCATGGTGGTCGTATGTGCTCTTCAGCTGGTGCAAGCCGCTAGCGGAGCGGTGCGCGCAACGGCCGCTGCGCTCC
GACGACCTGTGGACCCTGAAAGAAGGCGACACGAGCCAGTTTTGCGCAGATCAACTCAAGCGCGCGCTCACCAAGACGTTGTCGATCGTGCTTGCCGTGT
GCTGCACGCAGTGGAGACTGCTCATGTGCAGCGGCGCGATCTCGCTCGTATCGGTCGCGTGCGAGTTACTGGGACCTATTGCGGTGTACATTATCGTGGA
CTCTGCAGCGACGCATCAGATGCGAGATATGTACTCGCGCGGCGCGTTCTGGACGTTCGTGCTGCTTGGATCGCGCTTCTTGCGCTCGTACTCGCTCGCA
TGGGCCGATTACCTCTTGCGGTTTGTCGAAGCTCGGACGGCTGGCGCACTGCACGTGCTGCTGCTGGAGAGCGTGCTGGACACCAATCGCTGCCGCTCGC
CGCGCGTTGAGATCTCTGAGGGTGCGCCGAATCTGTTCACGACTGACATTTCAGCCGTTGGGAATGCGTTTCGCACGATCCATCGCTTGTGGATGCTGCC
GCTCGAGTTGTTTGGGTTTTTCATTATCTTCCGCTTTGTCGCCGGGCGCGTGATTACCAGCATCTTGGTCGTCTCGTTCATCATTTACGCCCTCATCCAG
CTCGTGAACTGGTCGGAGTCGTCGCTGTATCGACAGTGGCTCTCAATCTCCGACCAACGCTTTGGGATCCTACAGCGCATTTTCCAGAACATCCTCGCAC
TGAAGCTGAGTACGTGGGAAGAGTGGGCACTCATGCGAATCATGACGGCGCGCTCGACGGAGCAGTTTGTGCTCAGACGCCATATCTTACTGCGAACGAT
TCGATACACGCTGACGTGGATCGCGCCATCCCTGAACCTGATCGCGACGGGCGTGCTGCTGCTGATCGTCCCCAACTACGCGTTTGCGTCACCGGCGTTC
ACGTTCAGTGCTGTCGCGATTTTCCATGCTATCAACGACGCGTTTGTGACAGCAGTCGGCGTGATTCAAGTGTTTCTTCAGTTTCGAGTCTCGCTCGAGC
GGATCTATGCGGTGTTGCAGCTGTCGCATGTTCCAGGCAACACGACCATGGAACCTGCTGGACGAACGCACTCCCTTGGCAACGCAGATGAAGACGCCGT
CGCCGTGGTCTGCGCTGTGTTTGCCAACTCGACGTCTCCTGAAGCCCTAGATTTGCTGTCAAATGTCAACATCCGCGTGAAACGAGGGGAATTTGTTGTG
CTTCATGGCAAGGTCGGCTGCGGCAAGTCGGTGTTTTTATCAGCATTGCTAGGTTTCTTACCGAAGAAGGCTGGAGGAGTGTACCTCAATGGCTCCGTGG
CGTACTGCTCACAGGTGCCGTGGATCCAGTCGATGACGATCCGTGATAACATCCTCTTTGGGAAAGAGTTTGATGAGGTGCGATACTGGAGCGTGCTGGA
GGCATGCTGTCTGATCGAGGATCTGACAAGTCTACCAGCAGGCGACCGCACGATCATTGGCTCCCACGGGCTCGTTAGTATGTCTGGCGGCCAGCAAGCC
CGCGTGGCGTTGGCGCGCGCGTGTTACGCTGATGCGGACATTTACATACTGGATGCGCCCCTCGATAGCGTCGATAGTATTGTCCAGTGCGAAATTTTGC
TCAAGTGCATGGGCCAATTGCTGCAGGACAAGACAATTGTTCTGTCCACGCACAATCCCGAGTTGATCCTGTGCGAGTACGTCGATCGTGCCATTCTAAT
GGAGCAAATGGTGTTTCAGGAGCCTAAGCTCACGCAGAAGGAGGGGCGCCAGCCTCGTACGCTGTCTCGACGAGCTCAAGCAGAGAATCGACCTGTGTCG
CGTACGTTCGTGTCGAAACGGAAAGTGCTCCTCGGTGACTCAGCGACTCGCGGAGGTCTAGCGAGGAAACGCAAAGATTCGCCTCCTGTTTCATTGGTCA
CAGACGCTCGGAGACTTCGACTGAACACGTCGGTGCTTTTGAATCCGTTGGTTCTCAAGCTTCAATCTGCACCACGATCTCGACAATCATCGAGGCTTAA
TGTGGCAAACCACGCGTCGTGCACTTACCGCCGGAAAGGATGGAGCGCGGTGCTGAAGGAGTACATCGCGTACACGCAGAGCGTGTCAGTACTCTGCATT
GTCATCTTTCTCCATCATATGACGCAAGTTCTTTCCACCATGAGCGTGTACTACTTCAGTCGATGGATCGGATCTTGTGGAGACGCCGAAAGTTCGCCAG
AAGCCATGGAGCATACGGACATGCTGTTTAAGCGATACCTGTGGACAGTAGGTGGGAGCTGCGTCTCGTTTCTCTGTGCGGCGTTTGCGACGTTCTCGTT
CTCGCTGACTGCTGCTGGGAAACTTTTTGAGTGCATGACGTCGGCTTTACTGCACGCTCCGATGCGCTTTTTTTCGACAAACTCGGTTGGCAAGATCCTC
AATCGGTACGCTCGAGATCTAAAATCCGTCGATTCGTCGCTCCAAGGCGTCATTTTTACGCTGCTTCGCAGCTTTTTCAGCACTTATTGCTCGTTGTTTG
CGTCGCTGGCCTGGCTAAGCGGTCACATCCTGAAAGCCAACAGCCTCGCGCTGCAGAACGATGTCATGTCCATGATGGTGTGGTGGGTGGTGATGATTGC
GAATGTGATAGTGACGACCGGCATCCTTGGCGCGTTCTGGCGCGACGGCATTGAGTCGAACAAGCCGTCGGGTGAGATCTATCTGATGTTCCGCGAAACG
CTGTCGCCGATGTTCAATTATGTGACCGAGTCCATGAACGGCCGACGTGTGATCACTGCGTTTGGCTCGGAACAACGACTGCGCATCGCACGCAATTATG
GCGAGAAAGTGGACCAGGCCACGCGTATTCTAATGTCGATGTGGACGTTCGAGACGTGGGTCGCAATCCGCTGCTTGTTCATGGAGAGCCTGTTGACGAG
CTCGCTCTTGATCGCGCTCATTGCGTTTGGTCACGATCCGTCGTATTCCAATCAGCCGGCCACCATCGGACTTCTTCTCTTTCTGCTCTTAAATATCCGT
GACGACATGAAAAACAGCTTTGCGAACTGGAACCTGCTTGAAAAAGACCTGGCGTGCGTTCAACGCATCTTGGAGTACATTGACGTTGAGCCAGAGGGAG
CTTTGAGCCAGAACCAGTTGCCACTGGACCCATTTTGGCCGCGCAAAGGATCAATCACCTTCCAGGACGTGTTCTTCCAGTACGATGGAGCCGAGGCACA
GCCCCATCCACCCACGAATGCTGGTGCCAAAGCAGTTTTAACTGGAGCCATGGCGCTGAAAAACGTGAGTTTCCACATAGAAGGAGGCCAGAAGATTGGA
GTCGTGGGCCGAAGTGGTGCAGGCAAGTCGTCCTTGGCGATGGCGCTCATGCGCGTCAATGACCCAGCGTACGGCGTGATCCAGATTGACGGTGTGGACG
TGACGCGGCTCCACTTGAAGACGCTGCGCTCCAAAGTGTCGTACGTTCCCCCGAATCCAGTGTTCACGAATTCGTCCTTGCGTGAGTACCTTGACCCGAT
GAACCACGTCGACGATGCTGTGCTGTGGAAAATTCTGAAGAAGACTGGCGTCGAGGCGTCTATTTTGAAAGTGCAAGCGTCGCTGGATGCGCCCATCATG
GGGACGCTGTCGAATTGGAGCATGGGCGAGCGTCAACTGCTGTGTCTCGCACGAGCGCTGGTGTTCCGGTCGCGCATCGTGATCCTCGACGAAGCCACGA
CTGCTACCGACCAGGAAACGGACTGCAGCGTGCAAGATCTGGTGTACGAGATCCTCGACTCGAGCACGACGCTGCTGTGCATCGCGCATCGGCTGGACAC
GGTCCTCGAGTTTGACAAGATCTTGGTCATGGCCGACGGCGGCGTCGAGGATTTCGGCACGGTGCAGGAACTTGTGGCATCCGGAGACGGCGTGTTCTAC
AACCTTCTGGAGAGTGCGCAGCTCGTGTATTAGTGGGCGAAAGTCGTGATTATTAGGCGACAGACTACGAATTTTGTGAGTTTTTTGTTTGTTATTGGTG
TTAGTGACAAAATTAGTAGATGAATATGGTGAGTAGATTTCCTGATCGTTTGTGTGTAGTTGAAGATATACAAGCTATCGTGCCAAAGTGCTCTAGCACG
GAGATAAGCCATGTCTCTATTGCTTACGGCGTCACCGCCTCGTCGTCAAGCTCGACGTAGATCTTGCCAGGCAGCAGGAAGCCGTTGAACGTGCCGCCCG
TCGCGAATCCGTACGCGCCCATGTGCGGGAACGTGATCCAGTCGCCGATCTCCAGCACGGGGAGCTGCGTCTCCTTGGTGATGAAGTCCTTGCCGTCACA
CGTTGGTCCCCAGACACTCGACGACACAACGGGGCCATTCAAGCTCTCAACAGTAGCATTGTTATCCACGGCTTTGCCAGACATGACGATTGGGATCGGG
TCGTAGAGCTTGAACAAATACGGCGCACTGAAGGATCCGTGGACGCCGTCATTGACAAAGTACATGAACCGCGGCACGTGTTCGTGGGCTTCGTGCTCTG
CTTTCGCTCGCGCCGTCAGCGTCGGGTCCGTTTTGCGGCCAATAACGTTGAGATTCAACGTCGCACACGCCGAGACAAAATACCGTCCAGGTTCGGAGAT
GACTCGCACACCCGAAGACTTTGGGAAATACTCGTCGAGTGCGCTATTGACGGCCTTAGCGGCGTCTTGGATCGTGACGGGCCCCAGATCGTCGCCAGCG
AAGCCTCCACCGACGTTGAGTAGG