Description :
From Genome Similarity Track
Location :
Scaffold_42:595655- 597989
Sequence
2334 bases(100 bases per row)
TGTTTACAAGCTGCTCTTGGCGCTGACAAGTATGTCCCTACCGCCGACTGCAGCTGCACTGCAGCAATTCCTGTGTGCGGCAAATTGGCTACGAGAGTCG
ATGATTGATTATGCTCGCGTCGTTGGACCCTTGCAGTCCAAGCTGGAAGCAGTGATGTCACGTCGAGGACGGCGCAAAGCGCAGCTCGTCGGCGTCATGC
TCACATGGCCACCTGCAGATGAAGCAGCATTTCGTGCAGTGATCGACCTGTTGGCCACCTCCGCTAAGTTTTACTTTCCAGACCCGGACGCAGTTGTCTG
CATGTTTACCGATGCTTCGCTTGGTGGTTGGTCCGTAATTCTCAGCCAAGTCCGCAACTGGGCTGAAGGTGTACCTGTGACTGAGCAGCTACACGAGCTG
TTAGTGTGTCGTGGTGGTTTGTTTACGGGTTCTCAAGTGAACTGGTCGATTGTAGAGAAGGAGGCATACCCTGTGATTCGCGCTTGCAGCGACCTGGCTT
ATCTCCTCGAGCGGGAGAAAGGTGTTCAGATCTACTGCGATCATGCCAACTTGATTCACATCTTCTCACCTGACAAGACGGTCAAGCCACACTTGCGCGG
GAAGCTGCAGCGATGGGCCCTGCATATCGTTGGTGTCCGCTATACTATTGAGCACATTAAAGGCGACGATAATGTCTGGGCCGACCTCGTGTCTCGGTGG
GGACAAGATGGTGCTACTCCGACGCAACCACCGCAAGCAGTCAAGCGAGTGTCACTGCCAGTGTGTGACAGCGCAGAATACTCGACACCTCGCAATGCCA
GGCCATTTGACGCCGTTAACGTCTCCGATGGCTACTGGCAGTTTCCACCTGCCGAAGAAGGGGTTGATAAACTGACACTAGTTAAGAGAGTGACAACCAG
AAGCACTCAGCCGGTCTCGACGCTCCGCCCGCTGCAAGACGAGCACTTTGCGTGGCCAGCGGTAGGTGCAGTCCAAGACGAGCAGCACCGTTACCGCGCC
GACGCTCCGGTAGCTGCAGCCGATGATGGGCTCATCCGCGTAGATGGTAAGCTCTGGATCCCTAAGCAAGCTCACGAACTGGTGCAGCCTCTACTAGTCG
TTACCCACTGTGAACCGCAAGGGCATCGAGGCAGCGACGTCATGCATGCAGCGCTTACAGCCCGCTTTGCTATTGCCAACGCAAAGCCGATCATCGAACG
GTTTCTGAGGAACTGCCTGCTATGTAAGCATGTCAAGGGTGGGAAGATTGTTATGCGTGCGTGGGGGCCTACGTCTACTGCAGTGAAGCGCAGCGAGTGC
CTTCACATGGACTATCTGCAACTAGGGGATTCCTATGGTGCGTGCCGCTACGTACTTGTGCTCAAAGATGAGCTTACTCACTACTGTGAGCTAATCGCTG
CCGACGCAGCAGATAGCGCTACTGCAGTGCAGGCTGTGCTCGACTGGCACAAGCGGTTTGGTCTGCCCGAAATTTGGGTATCTGACAATGGATCGCACTT
CAAGGCAGCAGTGATGGAGGAGCTTGCCGAGCGCTTGCAAGCGACACAGAAATTTGTGCCCGTGTACACACCGTGGATTAACGGTACTGTCGAGAGGGTG
AATAGGGATATTTTACAAGTTCTACGTGTGATGCTCTTGGAGTTCAAGTTGGACACCCGCAATTGGGTTCACCTCCTACCCGTGATCCAAGCGAACCTCA
ACCACTCGGCAGTGGCATCTTTGGGGGGACATGCCCCTACTGAGCTTTTTACCGGGTTACCGGCGCCGTCTCTACTCGACACTATATCCGTCCCCGCCAG
CGACTCCTTTCGCTTGTTGCCGGTTGACTTGGTCGCGGTTGCACCACACCTCGACAAACTTCGGGAGCACCTGCATGGATTACATTGCATTGTTGTCGAG
CGCAAAGAACGCCGCCGCCTACAAGAAATGGCGCGTGCTAAGGGCACGGAATGCAACTTTGCAGAGGGTGACTATGTGCTATGGTCGCGAGTTGATAACC
GCATAAGCGGCAACAAGCTGCTGGTCCGATGGGTCGGGCCGTTTCGCGTGGTCCGCGCCCTCTCGCATTCGTTCATGGTGGTTCATTTGCTCACGAATGA
TGAGTTCGAGGTGCACGGATCGCGCCTCAAGCACTATTGCGACGTCGAACTCGGCGCCACGGCAGAGATTCGTGAGCACGTGGCCACCCAAGGTATTGTG
CTTGGCGTGCGAGCTATTGTGGATCACCGGTATGACACTACTGCCAAGGAGTGGCAACTTTACGTGGCGTGGCGTGGACTTGAAGACGTGGAAAACTCGT
GGGAACCACTCGCCGCAATACATCGCGACGTCCC