Description :
From Genome Similarity Track
Location :
scaffold_38:59555- 64089
Transcript NameFunction/comments
g12668.t1hypothetical protein
g12669.t1hypothetical protein
g12670.t1 hypothetical protein PHYSODRAFT_470590

Sequence
4534 bases(100 bases per row)
CGTAGGAAGTGCACGCACCGCCCCCTTGGCGATCTCAAACGCCGTAGACACCGTATGTCCATGAAATAGTGACAGGTAGAAATGCTTGGCAAACATCGTC
GCCGACGCGTCGACCACCAGTGAATCCGAGTGCACCGCCACGACATGCGGGATGCCAGCGTTCAAGAACACCGACGCGACCTTCTGGCTATGACACGCGT
TGACAAACACCAGCTGCACATTGCTATCCAGCGGTCTGGGCACAGCAGCAGACTTTCCCGTGGTTTCCATCTCCACAGGCGCAGCCCCCGGCACCTGCTG
CTGTCGATCGCCAGAGAACATCAACTGCCTCAACGCGTCCGGGGTGATGAGGTGCGTGCACCCCGCCCCATCTTCAAAGCAGAGCGCCGCACGCTGACCC
AGTCCGTGGCCGGAAAAGTGCAGCACCGTGCACTTCCAGGCCGTCATGAGGCTGCGCAGAATGTCCGCCGTGGCGATGTCGAAGCGTACGTGGATGGCCT
TGTGCTGTACATCTGTAAGCAGCGAGTTGCTGATCTCGCGCCGCTCTGCCTCCAGGTCCAGCTTCTCCATGGGGTAGATGCGGTGGCGACTGTCCTTGAT
CACGAGCGGCGCCGCGTGCAGCACCACCAGGTCCAGCGCGTTCTCGTCGCGCGGCAACCAGTTCGGACTCGGCTGTGACGAGGCAGTTGTTGTTGAAGTT
AATGGAGCCGGTGCTGAAGATGACGTAATAGCCTCGCTTGAAGTCGCAATCAGCGCCTCGAGCGCCTGGGAGAGCCGCACGCGGTCCCCGAACGCCGCGA
TGCCCAGGTCGTCACGCAGCGCGTTGCGTGTGAGCTCCGGCAGGATGGCGCCCGAGATCTTGTTGGCGGCGAAGAGCTCCGCGTGCTCGCCGAAACCCTG
CGCGCCCAGCCACTGGACCACGTCGGCGCACGACCAAGCGCTCCAGGGCGGAGCCGACATGCTGCCCTCCATTTTGAAGTGAAAGTGAGGTAGTCACTAG
ATCAGCGGGATGAATCCATACTGAAATCAACAAGGCGTGTGTGGAAAAGACTGCGTTATTAGTATCAGATCTGATTCCAATAGTTGCGGGTTCGGGCCAT
CCATTAGTGGAGCTGCTCATGGCGACTTCGGCAGGAGGCAAGAAGCGGCCGCGTGCCGACCTGTTGTCGTCGCTGGACGCCGCGTTCGCGTCTACTGCGC
AGCCTACAGCGTCTAAGTACACGACGCAAGCGGCTGCGCAGGCGGCCCCCAATGGCAACAAACAGCAGGCCTACCAGCACTCGAAACGGAAGCGCAAGGG
CGGCAAGAACCACGACAAAGCTGGACACGCGCGAGGAAATGGCAGGGAAGCAGCGAAAGAACAGGAGAATAAGAGCGAGTATAAGGTTGACCCGCTGTAT
GAGAAGATGGACGCGGAGTTGCTGGCGGTTGGGCTGAAGGACTGCTCGCTGGTGAGGACAGAGCTGTTAGGTTTGGTAGTTTTGATGAGGTGCTGACGCG
TGCTTCATTTGTGGTTATTGCAGCACCCACAAGCGAAAACCTTGACGAAGTCGCGGGCATTGCACGAGACATTCAAGAACTATCTGGAGTCGGTGGTGCA
GGGAACAAGAGCAGGTTCTACTGCTGTGGTCAGTCTCAAGAACAAGGTGCTGTCCTTGGACAACCCTTTCAAGACGACAGCAGCGGAGACCTCGGAGAAA
GCAATTACGGCGGCAAGCAAGAAGCAGACGGCCAAGCTGCTGAGTGCGAGACGGCGCAGGGAATTGGGCCTGCATCTGCTTAGCGGGAACATGAAGTACA
GCGATGCGATACTGCTCAACGATATCTGGACGAAGTTTGTTCGCCAGATTATTGAAAGCGAGGTGGGCGTCGTTCAGGACGTAACGGTCGAGGCGCAGCG
TACGCGAAACACGAAGCTCCAGGCTAAGCTCAAGTATCTGGATCTTTCCGGGTGTCCACTTGAAGGTGCGTTCGGTAGACAGCTGAGTTCCTCGTCATAC
AACTGGGACTAACAATGCGATCGTTGTTCTTTGCAGTGATTCAATCGCAGAACCCGTGCAAGGTTGGCCTCAACGGGATCGTCGTCGCGGAGACCCAACA
CACGGTTCAGATCTGCTGCCTTGCAGCTACCGGAGACGACAAGGACGACGGCCCTATTCGCAGTACGTGCACCCACAAGAGTCGAGTCGCCCATGCTCCT
CACCCAACCACTTCTTGTCGTTGCTAACACCCACTCTCGTTGGTGTCCACAGCTTTAGTCAAGTTAGATTCGCGCTTCAAGGTCCGCCTCGACTCCACTC
GAAACCTGTTCCTCGATGGTGCGTGGTTCGCTGAGCGTGCACAATAGACAGCACTCTCATCCGCTTGCTCAATGGCATCACACCCTTGCGCCGTTTGATA
CACCAAAACCAAATTGTCGTGTATCCATCTCACGAAATAAGAGCATAAATACTCTCTCTAACCGCTGGCAGTTAACTTTCGTCGATTCGGAGGTCGTTGC
TGGCATGGGCAACATCGCTCGCCTGTTGCTGCTGGGCGTGGCCTTCCACGCGCTGTGCATCCTCAGCATATTTGACATTCACTTCCAATCGCCCGTGGAG
TCCTCGATCCCCAGTAACGAGTACACGCTGACGCCTCCAGCCAAGCGGGTCATCATCTTCACGCTCGACGGTTGTCGCGTTGACAAACTCTTTAAAGCGG
TCGCAGGGCACGCAGACCGCTACGATCTCAATGCGGAGAGCGCCTCGACGAGCACCAAGTTCGCTTCCAATAGGCGCACTCCGTACCTGGGCGACGTAAT
GCGCAATCGCGGCAGTTGGGGCGTCTCTCACAACCACGCGCCGACTGAGAGTCGACCGTGCCACGTGGCGTTGACTGCTGGAATGTACGAGGACCCGCAC
GCAGTCACCAAGAACTGGAAGCAGCATCCAGTGCCCTTTGACTCGGTCTTCAATCAGAGCAGTAGTGCCTTTATCTATGGCAATAAGGATGTCGCTCCCA
TTCTGGCAAGACACGCCCCGCAAGCGACGGAAGAGCACTACACGGCGAAAGAAGAGGTCGATATGATACGGGAAGACACGACGCTGCTGGATGTGTGGGC
GTACGAAAAGATGAAGGATTTATTTGCACGCGGAGCGGAAGCGAAGGATCCAGATTTGTACAAGAAGCTGCACCAAGACAAGTTGGTGATTTATTGTCAT
TATCTGGGCACCGACTTGACGGGACCCAAGTTTGGTGCTGATTCGAGAGAGTATTTGGAGAATATTGCGGTGGTGGATGAGTTGATTGAGAAGACGGAGA
AGATGATCGATGCGTACTTTGGAAACGACAGACGAACGGCGTATGTGCTGAATTCAGACCATGGAATGGATCTCCGTGGTGATCACGGGGATAAGGATCC
ATCTAAAACGCGGACGGCGATCATTGCGTGGGGGGCAGGTATCCACCGTCCTGTTGTGGTGAATAGGACAGGAGATGAGGGTTTTGATTTTGACGTGCCT
ACACAGTCTAAAGCTGAGGTGCAGGTACGTCTGGAGTCCCAGGAGACTGAGGAGCAAGTTGCAGCACAAGAATGGAGAACGCTAATACATTTCAAGCGCA
AGGATGTGATGCAGATAGACGTTGCACCACTCATTAGTGCGCTAGCAGGGCTTCCATATCCTCGAAACTCGGTAGGTGTTCTACCGTTTACGTACTTGAC
TAAGAACAAGTATCGTGTGAATGCCATGCGCGCCAATGCACAGCAGCTGTACCAGCATGCATTGCGCAAGGAAGAAGTGAAGCACGCTAACCGAGGGTTA
CTGTTCATTCCCTACGCACCACTTCACAGCCGTGTGCCAGATCTGATGGCCCATATTGACGAAGCCCTCAACAGCATTCCAGCAAGTGACGGTGAAAGCC
ATGCAATTCACAACGAGGCACACCATGTCATCGAAAAATTGATCCAGGAGATGATCGATATCTGCCGGAATGCGATCATATACTACCAGAGATATGACTG
GTTGTTTTTGCTAGGATCAGTCATTCTAAGCTACGTCGGCTGGGCTCTAACCATGACTGTTGCCTATTTACAGCCCCAAAAATTCCGAGTGTCGTGGCTG
TTGGTCCACATGATTGATGTAAAGTTTGTTGCTGCTGTGGTAGTAGTGATGTGGTGGCGCTTTTTCGCCAACTCGCCATCGACATACTATCTGTATGGAC
TGTGTCCTCTTATCTTATGGAATTTCGTTTGGAACTATCGCGATAAACTCCAAGCTGCACTCCCTCTTGCTCAAGATTTTGGGTGGCAGCAGAGTGTTGA
GATTGCAGCAATATTTTTGTGTCTGGAGCAAGTTGTCCTTGGTTATCAACACCGAGCCATATTCAGCTTATTGTTCCTTCTGCTTGCGTTGAGGCCGAGA
ATTGCAGTTGGGCACGTTCGAGAACCAACCCGTGGACTGTACCAAAGAGACGGTGGGAGAAAGTTGACGTCGCCAACTTTCTGGTGGTCTGCTAGTTGCC
TGCTTATCGCTATATTCCCCTGTTTGCCAAGTGA