Description :
From Genome Similarity Track
Location :
Scaffold_240:5954- 8220
Transcript NameFunction/comments
Phyta_totarag6047hypothetical protein PHYSODRAFT_511709

Sequence
2266 bases(100 bases per row)
TCGTCGGAATGGTCCTGTACATCCGGAAACACTGGACTTGGAGGATGTTTCAACATGCCACTGCAATTACCTGCTAAGCTGGACCCGGAATGACGCTGCA
CCAAACACAACGAGCGCAAAACACCCACGGCCCGCGGCCGGCGAAATCTCACGTACATATATTTTCATCGCTGATCGAGAGAAGCCCGCTGTTTGCTGAA
CTTCGGCTCGTTACCATTGCCTGACTCTATAACGCTAAAATATAGGAAGAGAAGACACTTCGTCCGTGCAGTTCCATttgctgttgatgttgatAAACCT
TAGTGCTGTAGAGGAAGCTGGCCACGAGCCGGAGCAACTTGTCGAGCATCAAATGACAAAATGCGGCCCGATAGTGTACACACTCGCTGGGTCGGCGTCT
ACGCTCTTCGTCTTGATTCTTCAAGCCGTTTGCACTCAATGCTGCTATCCGTGGGTTTCTTCTCACTTTCTCGGACTCTGGTTCCGCTTGTACGTGGACT
TCTCCGCCGTGCTTGGTCCATTCGACGGGTTGTCGAGGCTGGAGTGTAATGTCAtttcgttgtcgtcgtctcttACTTTtgatgtgtgtgtgtgtgtgtg
ctgaTGAGTTCGTTGATACTTCTATCCATCGCGCGTGCTATTGCTGTCTACCCGGGGCTCTATTCAACCCGCTGCTCCGGGATCCGCTCGAAGCGCCGGT
TATTCGAGGCGCCACAGCTCATATTCTTCGGAGGTCCAATGTGGATGGATCCGCGGTAACTGCCTCCGGCGAAGGTGTTTTGAGGCATGCCCATTTGCGC
CCGCCGCTCGCGCGTGCAAATGTAGTGTCCGGCAAGTCCTTCGGCCGGGATCAGGTAGCCCAGTGTGACCGTACGCCGCGGGCCTTCGCGCACTGACGGA
AGGCCTTCTACCGGCTGCACGGGGTCAATCTGGAAGCTCTCGTCGTTGGAAatcagcaccaactcaaTGTTAAACATGCTCGCCACCGCATACAACTCGG
CAGTCGTAGCCTGCTCGTCTGGTGTGTCTCTGAAGGTCTCGTACTGCTCTTgcacgtcctcctcgtcctgcatGAGGAAGCCCGCTAGTTCCTTAATGTG
TTCCAGCGCGTATTCCATCAGCTTGACCCTCAAAAactgagctgctgccactcgtCGCGGGGCCATACCATCCGCCGCACCCACGTTCACCACCGTCATA
CTTGCCGGGTAGTCacgcagacactgcagcggaTACATCTCATACACAATGCAGTGCAGCAAACAAGATCCGTCGGGCGGCATGCCGACGCCTACCAGTC
CCATCTGCACCAGCTGATCCTCCATCTTTGCTCGCTGCATGTCCAGTTCTGGCGTAATGACATCGGGCGCCGTCATAGCCATCATCGATCCTCTCGAGAT
GGACGCCATGGACGCACGTCCGGTCGTGTCCGACACGGTTGAGGACGCCGGGAACCAGCTTCCTCTCGACGATCCGGGGCCGATCGACCCGGCAAACGAA
TTGCTCGCAAACGACCCTCGACTGCTCGCAAAGGACGTGCGTCCTCCGCCCATCTGCACTTGGGGCACTGTATGTCTCGCGAAGCTCTGACTGCCTACGA
AGCCCGTTCCGGACCAGCGGTAGTCACTGGCATTGGAGGCGAACGAAGAGACTGTGGAACTACTCGAGACGGAGcggaagtcgtcgtcgtcgtccccCAT
GACACTGGCCGTGGCTTGCATGACCGCGGGCGACGCCAGGATGGAGGACGAGGGGCGGAGATTCACGTCCTGCTGGTCGTAGTCTGCGTTAGCTCCGAAG
CCCGAGTTGAAGCCCACGAAGCTCTTGAGCGTCTGGCTGCTCACGGCCGCCAAGTGGAAGGCCACGAGCTGCGGCTTGTGCGTCACGACGTTCACGTAGT
TGTCCAGTTCGCGGGCTCGCGCCCCCAGGAACTCGGGGCTTTTGTCCGCGCGGAACAGCGCCTTGCGACGGTACAGCGGGGGGAACTTGACGCCCTTCAT
GAGCGCGGCGTTGcgcttgcgcagctgctcgtcgagcttTCGGaaggccgagaagctgcgccaGATGTGCCAACTAGTGCGGCCCGTGGCGTGCGCGCGC
GACGAGTAGAAGGtgagctgcaccacgacCTTGTActcggccttcttggtgctcagGCGGTAGTCGTCCACGCTCACGGCGCACGTGTAGTCGCCCTGTA
TGTCGTCGGGCGTCATGGTCAGGTAGGCCATGCAGGCGGCCGGGCGGTTGAGGGGCGAGAGAGGGA