Description :
From Genome Similarity Track
Location :
Scaffold_231:5954- 7761
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_231-snap-gene-0.15Malonyl-CoA decarboxylase (MCD)

Sequence
1807 bases(100 bases per row)
TGTGGCGGCCCTTCCACGCGACAGACGTCGGCGATGGACAGCGCGTGCCGCTGGCGCCGGAGGACTCGACGCCGTCGACGTTCCTACAGTCCATCGACCT
GAACAaCCCGAGTTCCGATGATCGCCAGAGGCTGTCGAAGCTCATCCAGGAAGTCGTGCAGACCAAAGCCAACACAGGCGGTGCGTTCATGCGGTGCGAA
AGCGACTGAGGGATGTGCTGGATGTGACAATGTGTTGTGCGCGCGGAGCAGACTTTGTGCCCCGCGTGATTATCGGAAACCTCTGTGCCAAGTACCGATC
GCTCAACATCGACGAGAAGAAGCACTTCCTGCTCATCCTGGCACGGGATCTTCACGTCGACATCTCGTTGGTCGAGCGGAGCCTcAACtATTTtGCGgAg
AACTTtGCGCACGTCCAGCGAGACGCTGAGGCGCCAGGGGAGAGCGAGATCGAATGGGAGCATGAGCAGATCGAGCGGTTCCTGCGCACCTTCCGCAACT
TGCGTACGTCCCTCACGCCGCTCTACGAGGTAGACAAGACCACAAGACCCATTGGATTCTCAAAAAGCTGTTGACTGACTTGGTCTTTTtGGAATAGACC
TTCTTTCAGCAGGTGCTTTCGCAGCGTGAGGGCGGCATGCTTTTCCTTgtCCAGATGCGAGCCGATCTGCTTCAGGTGCTACGGAAAAACGCCGATCCCG
GCCCGGAAGCGTCGGCATTGCGCTCATTGGATGTCAGTCTGAAGGTGAGACATAGCTGACTGGGTCTTTCGATCCCGTCcTTCCTTCTCAGTGCTTCTta
TtGCTGCTTgTAGAACATCCTTGCTTCATGGTTTAGTGTTGGTTTtCTTAAACTCGAGCGCGTCACGTACGAGAAGTCGCCAGGACAACTCCTGGAAAaG
ATCATCCGATATGAAGCAGTTCATCCTGTGGGGACAATCATTGAGCTCAAGCGACGACTAGGACGCGGGCGTCGTTGCTTCGCCTTCTTCCACCCAAGTG
TACCTGATGAGCCTCTTGTCTTCGTCCATGTCGCCCTGGTGAAGGAGCTAGCTGGAAGCATGCCGTTTATAAAGGAaGAaaCGGAGAAGATGGATGATGA
ATCCCAAGCGCGAGCTGCTATATTCTACTCTATCTCTTCAACGCAGAAGGGTCTTCAGGTGAGCAATCGAACATCATAAGTATGGTGACCAAGTCTGACG
CACTGATACGcTAGGGAGTGGATCTCGGAAACTTCCTAATCAAAGAAGTCGCGAAAGAGTTGACGCGCGAACAGCCCCAGCTGCGGATCTATTCAACGCT
CAGTCCGATCCCAAACTTTGTTCCTTGGCTCGAGAGCCATCGCAACAACGATCAGCTTTTGCATCCATATCCAAGTGAAATGAAGGGGTTGCGCCAAGTT
CTTGGAAGCAATGCGGCAACTGACGTCGGAGTTTTGTTAGAAGCGTTGTCCGTCGAGAATTGGCATGAGAAAGACGATCTGGCGTTGGCTCTCAAGCCCA
TTCTCCTACGCCTCGGTGCTCGCTACATCTACCAAGAGAAAAAGCGTGGAAAGGCACTGTGCCAAGTTGCCAACTTCCACATCCGCAACGGAGCCATCTT
TGAGCGCATCAACTGGCTCGGGGATCCTTCGGCCAAGGTCCGTAATGACGACATGTCCTCAAAAAGCTCGATCCTCGCTAATGCCTCTTTCATCTGACTG
TAGGGCCTTCGCCAAAGTGCTGGGATGATGGTCAATTACAAGTATGACCTTGCCCGCGTCGAGAACAACAACGAGAACTATCTGTTACAGAACATCATTG
CCATTGG