Description :
From Genome Similarity Track
Location :
contig_68:59528- 62229
Transcript NameFunction/comments
g9626.t1hypothetical protein

Sequence
2701 bases(100 bases per row)
CTTAGAGTGACCACACCGGTAGTTGCTATTGCTATCCTATATTTAGCAGCGAAACCACATGTCCCCTGGCTGATAGCATCAGCCAAAAGCCAATTTGACA
CCGGTGGTGCGGCTATTAACTACGTTGAAGCTATGGTTGATCAATTTTCGTCGTCTTGGTTGACGGACTTGCTTGATGAGGGGAATGAAGAGGAAGCTTT
TGTTCTGAATTTAGTGTTGTCTAAACCTAGAGGCTTGGATTTGTCGTCGTATCCGAGTGGTTCGAGGCCAGGCAGAGCCGCAAACAAGGATCGTCGAGCG
GCCGACCGTCATTTATGTCTTCTGCAGCAGTATTTCGGACCAAAACCAGTCTACGACTCATCAGCGTTCCGAAAGCGCTTTCGAATGACCCAACGTTTGT
TCACAAAGGTGCTGATAGCAGTCGTTGAGACCGATGACTACTTCGAACAGAAGGCTGACGCTACCGGTAAGCTAGGCATCTCGAGTTTGCTTAAAGTTAC
TGCTTCATTACGACAACTTGCATATGCATCTGCTGCTCACGCGCTTGACGAAAACTTGGAGATAGCAGAAACTACGGCATTAAAATGCTTGAAACGCTTC
TGTCGTGCTATCATCGCGCGGTTTGGCAGTGCATATCTTCGGTCACCAACACCAAGTGAATTACAGGAAATTCTACAGGAAAATGCTCGCCGTGGTTTCG
TTGGGATGATAGGCTCAGTAGATTGCATGCACTGGCAATTGAGAAATTGTCCGACTGCACTGGCCGGACAACACAAAGAGAAGGAGAAAAAACACACTAA
GATTCTTGAGGCCGTCGCAGACTACAACTTACGAATTTGGCACTGCAACTTCGGGTCTCCAGGTTCTCTAAACGATATCAACGTTCTGGACCAGTCTCCT
TTGTTTCAAGATTTTCTGCAGGGTACTGCTCCCCGTGTCGAGTTCATGATATCTGATACGATGTGCTTCTTCACATTGGCTTTCTTAATTACTACAAACT
AAATGTGAAACTCGTAGGAAAGCCGTATGACACGCCGTACTTGTTGGCAGACGGAATCTACCCTGAATGGCCTGTGTTTGTCAAACCTATTGAGAAACCC
CATGGATTAAAACAAAAGCACTTCGTCAAGCGACAGGAAACTTGCCGGAAGGACGTGGAACGATGCTTCGGTGTGTTACAAGCGCGATGGCGCTTAATTG
ACACTCCCTGTCGTCTTTGGCGGGCAGATGCAATGGCCCACGTGATGCACGCTTGTATAATCCTCCACAACATGATCATAGAAGACGAGCTCAGTGATCC
CTATTGCAATGGGCATGAGCATCTTTACGATGCCGAGGCGCAGCCTGGTGGCATTCCAGTATTCAATATTGTTAGGCCACAACGACCACCGCGATCTTCT
ACAGTTGCTACGCTGATATCTAAATCGCACAAACTTCACAACGCTAACCAGCACGCTCGGTTTAAATCCGTCTCACAGATCTCTTGGACAATGCGCGGTC
TCGAAAACTAGTTAAAATTTGCAATATACGACCCTTGTGGTTTGAACTTAAGCAGTGCTAGATAATGAGCGATGATACAACATCGGGTGTTGTCGTTGCA
GTAATTGTGGGGGATGATTGGGCTGCTGGAGTTAATGGCGCGGTAGTGATGGGCTCTGCTCTGGCTGGATCCGGCTGATCACCAAGCCGAGATCCATGTC
CTGCAGCTGCAGGAGTCTCTGTGTCAACAGCAGCAACCTCTTTACGAAGTCGTGCTAACACAAGTCGTCGTTTGAGCGCGATGAACTCCATCGTCTCCGG
GTCGCTAGTGTTTGTTGCCATGCTAAAAAGATTCTGATCAACTCGATCTTGAGCCACACGAACGCGAGCATCGGCTGTTTTCGCCATTCTTTCGGTGGCT
TGCACTTGTCTAGAGTAGAGAGCTAGGTTTGCGCGCTCCATTTCAGCACGCTGCTGCCCGATGGGGCGCTTATCTTCTGCTTCTGTTTCTGCTGTTGATG
TACCGTCAGATGTGCTACTCCCGATACCGTCCACAGATTGTAGTTCAGTCAAACATTCGACTGCCGTCCGCTTCCTGAGAGAGGTCTTCTTGGGTTTCCG
TCTCGCCAACGCCCCACTTTGGCGAGTCTTTCAAGATGCTCCAGCACTGCAAGAACCGGAATTTTCCGCTCTCAGCTTCGTACAGCTCCACAGCTTGATG
AATGATGTCCGTTGGAGATCTACCACTAACATCCAGCCGTTCCACCTGCTTGAAGCAACCGACAAACTTCGACACAGACCGCGAAATTGTCTGGAAGCGC
GACTTCAGCGAGCCAGGATTTCTCGTAGTAGGAGTCCCTAGAATTTCTTCAAACACCTTTCTCACCTTGTGATACATGTCGTCTCCGGTCTGATTGATCC
CAGTTGGAGGATCACAGCTAGCATTCAGCCATGCCTCACACAAAGCCTTATCCTCTGCAGCACTGTAGTTCGCTCCTCGTTTCTCGGACATCTTGCAGAC
TGTTCACCACTCCGCTGGTGCTATTTTCAGAGACAAATTTAGCTCTAGATGTGGCCCCGATGGCCTCAAAGCTAAATCTGTTTAGCTTTTAGCCGCCCCG
GTGGCGCTGTGCAATGCTATCCTAGTGCCAAATCTGGCATTTTGGGGCGCTAACAGCACCCCGGTGTGGTCACTCTTAGAGTTTGTAAGGATCAAGCTTG
G