Description :
From Genome Similarity Track
Location :
Scaffold_737:5952- 6980
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_737-snap-gene-0.18CRAL/TRIO, N-terminus family protein

Sequence
1028 bases(100 bases per row)
GTCGGCGTTGGCACTGGCAACGGCGTGTCCGCGACCGAGGGCTTGAACGTGTTGTTCATGGCGCGGCCGTGGTGGCCGCCGCCCAAGTACGAAGGAATGG
ACTCCAGCGGAATGCCGTGGCTCTGCGCGGCTTCCAGGAACTTGTCGCCTTCCTTAAACACTTGGATCTTCTCACGGGTCTCGGGGTCAATGAGACTCGC
GATCATCTTCCACGCGCCGTAAAACACGAACGGCGNNNNNNNNNNNTTAATCAGGTACAGGCGATGCAGCGTCTCCGGGTAGTACATCTGGCCAATATCG
AAGATCGGCTGTCATAAAAGCATAAAGAAATGGGTGGGTTGCCTTATGAATATGGTAAGAAAATGACACCGACAAGCTGAACTCTTACCTTTAAATAATT
TATGATGGAGCGCGACACGTGCTTCATGCCGAGTCCCTTGAGGTCGACGATGCAAATGTGCTTATATACGCGCGCTCCCAGTCGCTTCGAGACCGCCNNN
NNNNNNNNNNNNNNNNNNCTTTTTCCCACTGAATGCGCTCCATGTACTGCACGCGGTGCGGGAGCAACTGATCAATGTGCGAAAAGTTCTTCTGGAACGC
GTCAATATTGATCTCCTTGATGCGGTCCACAGTGATCAAGTGGCCCTCTTTGTCTTCGCCATAGATCTGACCAGGCCAGCAGTCGAAATATATCTTGCTG
TTGTCCAGTTCGCGGGTCAGGATGGTCTCGGCGTCATGTGCCGCGCGCCAGTCGAGAATGCGCTTGGCTTCCGCCAGCGTGAGTTGCATGCGGTTCTTCT
TCTGCGAACGGAATGCGCGCGCCATGCGGATCGCAAAGTCCTCCGTGCACGTGTCGCCATGCGCAGCCTTGATCGCGTCGTAGAACTGCTGGTCTTCCGC
AGTCAGGGGCGCGCTTTCTTCGTTCACAGTCATCTTGCCTTCGTGTGCGCGTGTGTGGAGATGAGGAGAGCGGTGTGCGCCGTGGAGATTTGAACTGCGA
ATGCCGAGTGAACGGGAGAAAGATTTCG