Description :
From Genome Similarity Track
Location :
scaffold_62:59514- 65847
Transcript NameFunction/comments
g1836.t1hypothetical protein
g1837.t1 PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
6333 bases(100 bases per row)
TCCGAGTGCTGTAGGCGACTACAGCGCTCGCCCAAGTTTTACGCCCTTCGGCGGAGGTGGCGGTGGCGGCCTTCGTACGCCGTCACCATTTCCGGAATGT
CCTCCATCAGGACATTCCGTGATTCCCACGTATCGTGTTGGGGAGGAAATCCTCTCCAACGAATACGAAAATGAACCGGACCTCGGGTCTGGTTCCGATG
ACCAACAATTCGCTGGACGATCCAGCGAGTTGCCCCGCGTGCGTCTCGCAACGGGGGGGGGGGGGCGGGAAGACGCCCCGGGTTTGGTCAACCAAACCTT
GAGTCTCGCTTGGAGGCTGTTGAGCGTCTCCAAGCGTCGCAGTTCGCTGCTCTGCGTCAGGAGCTGAGCTTGTTAAAGGCTCAGCTCGCGGAGGTTGCGC
AGACGACCTCGAACGTAAAGGTCGAGGTCGGGACGAGGCTCTCTGGCGCCTTGAAGCGCGTCGCCGCGCTCGAGAGCGCTTTGGCGAGTCACCAGACGTA
GGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCT
TCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAAC
TAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAAC
CGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGT
TATGTTCGTTGTCGGTTAAAGTGTCTACGCCCGTCGTAGACACTGTCTTGTTGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATAC
ATTGCTCGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGTATACCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGT
GGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCAGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATT
GATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGCCATGGA
CAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGTGCTGTGAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTA
AACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACGGCAGCAAGATGCACCATCTTGCTGAAGTGGTCAACAAAGACCA
CTATACCAGTCCTCCGCTTGTTGTCTTGCAGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGG
AGCCTGCGAGTTGGGCGCAGGCTTCTCACGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCATTTGTATTGGTGACTCCAGTAGAAGTCACGC
GTGAGAAGCAAGTATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCA
CGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAATGCAGCAGACCATTGTGTACACGATAACGGTGTACACGAGTACGAAGGTGTTTGGCCAGCTT
CTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCATCATGCGCGTATGCGGCCTTCACGTCATCCGACAAGGACGAC
GAGGGTGTAGTCGTCCTGACGACGCCAACGCAGTTGGCGTCGGCCTCTTGCGCCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACC
TTCCAGTTTTGTACTCAACCTGGAAGTTGTATTCCGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTAGTCGCCGTACGCAA
CGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGT
ACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCG
CGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGC
CTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAG
TACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGT
TCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAA
CTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGC
ACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAG
TGCTTACCGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGA
ATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGCGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGT
TTCTTCACACAGAACGTAGGTGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTT
GCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACACTTGTCCTGCGGTAACTCCGCAGG
AATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTC
GACTTCGCGCTGAGGACGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCT
CGATGCGTCCATCGTGCAGGTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGGTTATCCAGCCTCAT
CTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGC
GTCTCGGTCCGTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGG
CCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCATCGCTTCGTCGTGCAGCCCGGC
TGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTA
CGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTACCTGTCGACACTACCGCGTCGCTCCGGACGCTTCGAGACCCTCTCGAATCCGATT
GAATCAGGCCCTGCTGATTCGGTTCACATCTTCTCCCAACGACTCTCGCGGTCGTTGGCGTTCGCTTGGGGGTGACCGGAGACAGCCGCATTTCGCGCTG
TCTCTGGTGGAGGGCCGCATGCATCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCCCTCTGTCGCGCTGCTGCTGCTCGCGAAGCGCACGATCGT
GCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCG
ACGAACTCATTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTACTCTCACTTCCAATAGACTTCCAG
GTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGGCGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCT
CTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCACTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGT
CCGATGTCGACACGCTCGACCGCATCACCAGCAGGCGCGGGGCGCCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACG
ACAGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGATCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGC
TGGGAACCAGCAGCTGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCA
GTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCC
ATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACTGTGCTCTTTGGGCGTAAGCA
TGCACGTCATGCTTGCCCTGTTGTAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGTGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAAAT
CCTCGTACGTGCTAAAGCACGTAGGGTCCGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGA
CAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGCTGCCCCTCTCTTCCAACGTAGCTGCTTACGTGA
AGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGCTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGT
GTTGCTCCGTCGGTGATAGCGTTTGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAG
GTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAAGGCAGGTTCTCAGCCCCGCGTTCGTAT
TCCATACGAACGTGTTAGCCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCA
CGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCGCAAGTATACTTAAACCTAGATAAATGAACCGAACGAAAGCTTTGGT
GTAAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCT
ATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGAGTGGTCACCTGAATGTAT
TCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG