Description :
From Genome Similarity Track
Location :
Scaffold_10:595126- 597234
Sequence
2108 bases(100 bases per row)
TCTTCGACGACGCCTACAAATTCTATGCTGCGTGGCGCACGACGTTTGAGGAAGGGGCAGTGATTGCAGGCCTCTTCTCCCTCTACACCAACGAGACCTA
CTGTCCCACGCGCATTGAAACTGACGCCTGCACCATCAGCCAGGCCAAACTCCAGGTCGACAAGACACGAAATGACGCGAAGTACTCCAATCGACGGTTA
TGCTGGTGACGCCTTGGAACAGCGCCTTGCAGCGGTGAAACGCCTCGAACAAGACTTCACGCGCAAGTTTCTAGACGACTACATCGCGGAGTCTCTCGCT
GCCCTACGCGTCCAAGCTAAGGCTTTTCTTCTCAACTCGCTCACGCCTATCCTCCAACAAGTTATCGGATCCCACGGCCCTCCCTTCTCTGTCTGGGCCG
CTCTTATGGCGCGTCATGAAGCCGGCACCCGCGACCCCATGATCCTGTTTGCGAGACTCACCCAACTCAAGTACAGTGAGGACATCAGTGCCGAGACCCT
CTTCACTACTCTCAACGATCAGATTAACTAGATCGAAACGGCAACCCTCCCTGCGAACGCTGACGCTCTAACGGCTCGCGATTGTCATGTGAAAACGTTT
GAGCTCTTTCGTACTCTCTTCTACTCTAACGCCTATGCCGCCAACAAAGACGTGTGGGACGCCGTGCCAGCTCCAATTCAAGGCGCGTGAGGATGGCTCT
GAATGCACGCCTACTGCTATCAAGGCTACTATTCGCCACACCCTAAACATCGCCTCTCGCCGCAATCTCATTCTCTCGGATCAAGGCTCCGGTGACTCCG
AATCCCGTCGACGCCAAGTTGCTGCTGCTGCCACCTACACTACGCACTCCTACCGCCTTGTATGCTACGCCTGCCACTACCCAACCTCCGCCTACTTATA
CTGCTGCTGCTGCCCTACTTACGAGTCACTGCACGTTGGGCACACTCAAACTGTCACAACTATCCTTTCAATTCTTGCTTCTATTGTGGCTCGCCTGAAC
ACCGCCTTCCCGACTGCCGCACAATGTGCGATGACGACAGTCGTAACTGCATTCGTGCCGGTGTTCCCAAGCACATTGTTGACACACACTGCCGTCGGAA
ACGCGCATTGTCTTGCAAGATCATTGACGATCATACGCAACATCATCGCCGCGATCACGACGACAACCATGGGAACGATCAGGGTCCCAACAGCAGCTAT
CCCAAGCGCCATCGTGACGACTCTCAACCGCCTCCCCGAACTTCTACTCGTCGATCGCCTCCACGTTCTTCGCAGCGAGGTCGTTCCTCCGGCCGCTCCT
CTCGAGCTCAGCAACGCATTCCTACTCCATCATTTACCACCCACCCAGACTCAAGTCGTAGCCGCCCCACATCCCCACCATCCTCCGCCTATCCTCGCCT
TTCGCCAGCCACTCGTCGTGCTCGTTCATCGCCTCCTAAACGTCGCACTTCTCCATCACGTCCATCTGCTGGATGGAACACGTCACAAACCTTTCATCCT
TCTTCCGCCTTTCTTCGACGCTCCACACCAGCACCGCCTGAAAAATGACAACGCCTTCCCAATCCCACCTCTCAACCCTCAACTACCAAGGCATCAATTC
CGCCTACCTCAGCTCCAACGCCACGTCCTTCATCTTCCTCTACGCCTAACGCCCACACTCGGGCTACCTCCACAGCACTCATCGTTCAGCCACAGTTTCC
ACATCAACAAAACTACATACCACTTCCTCCCACCTCTTCCACAGTGGATGACTCTCTACTGCCCCCACTCTCCGCCTATCGTATTCATCCTCCGCGTACG
CCTCCCAACTCTAACAAACTCACTACACGACCTCCTACGCCTGCCGATTACGTTGACCCGCCTGCACGACAGTTACCCGTACGCTCAACCGTCGTGGTGG
CGCCTACAGTGCACCTCCGCCTCCTCGTGCTGCGCGCCCTTATTACTCCTCCGATGAAGAAGACCGCTGGGGTCCAATTCATGACGTCGCCTACGGTCAA
ATGGCCAACATTACTGCCGACGCCTTTCACCAACTGTCCTATGACAAATGTGTCGCCTATCATCTCTTCAAGCACCAAACCGGTCTCCATCCCAAAGCGC
GACCACCG