Description :
From Genome Similarity Track
Location :
scaffold_26:595122- 596446
Sequence
1324 bases(100 bases per row)
AAGCTGCGATCTGCAAAGATCGAAAACTTTCTTGCGATAGGCGAGTTTCTTAAGGCAGTCTGTATAGGTGCGTGATCAGTGTAAATAGCGAGCTGTTCCT
CACCAAGCAAACAAACTAGGAACTTTGTCAACACGTATTTCAAGTCTAAACGCTCTTTGTCGTCAACAAGATAGTTTCTTTTTACGGTCCATAGCTGTCA
TGACTGATGCAACATAGTTCTTTTGTTGCTTTCATTATCGCGTTGTCTTGGTGCACATCCGATGATATGATTGCTCACATCACAGACTACATGGGATGTC
GTATCATGATCTGCAAGAGCTAGGAAAAGCGTTTGTCTTATCCTTTTTATCACTTAGATAAACGCTGCCTGATACTCCTCAAATCACTATTTTTTAATGC
GACGCGTGAGAGGTTACATCATCGCAGCATAATTGCGtgtatatttgtgcaagtagtttgcCGAATCCAACCGCTGACGTAGTTATTAGACATCATGAGA
AACTGGCCAACAATCAATTACTTCCACCTTTTCAGGATCTGCTTGAACACCATTcttgccaacaaagcaacCAAGTTAAGGAATCTCAGGGGCGAAGAAG
ATGCGTTTCTTCAGGTTCGTGTAACATTCATGCTCTAGCAAAAACTACAAGACTTGACAAAAATGTACGATGTGGACATCAACACCCTTCTGCTTCCCCG
AAGTTTTACAAATAGATCGGGGCAAAATTTCTCAATGGAGAAAGCATTTTCGGGACCGTTCTATCAGATCGTTGGCGCTCTCTTATGGCCTTGTGGCTTT
GCCATCCAATCACACAGCATATTTCTGGATGGACTTAATGCAATGGATCTCAGGCATACAGCTATataaaagtatttttttgatcGATAGCGCCTTAGAC
GGTACTGCCAACCATTCCATCAAGAATCATAATCTTTGTGGAACAGGCGCCTGTGCAGGTATTTGAATTGCTCGATCTGTCGAAAGTGTGAGCGATGCAT
CGATCACCAGTAGCTTTCCTTAAGTGGGACTACAGTGCATAAACTTGCCCCCACGCATATGACCAGCCTTTATTTGCTGCGCGAAGACCTCATCCATCCC
AGCAATTATTCCTGCGATCGCGGTCATTGCCATGAGAGAAATGCTTTGTACCTAAAAATAACTGTATCCCGTGATGAATGCCTCTGTTCTGTGGCACTTT
GTCCAGCACCTTGTCTAGGGATATGTCAGtagattttttgaaaagtccaTACACGGAGATTGTCCTTAAAGCGTCCCACAACTGCTCACCGACCGTTTTT
TGTCTTTGCATCTAATACTTCCGC