Description :
From Genome Similarity Track
Location :
Scaffold_761:5951- 8499
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_761-abinit-gene-0.12Pax-interacting protein
Pytve_DAOMBR484maker-pve_contig_761-snap-gene-0.8Conserved gene of unknown function

Sequence
2548 bases(100 bases per row)
TCCGGCTGTCGTCATCTGCAGTATCCCGAGACCTCGGCGGCGATAGCAGCGGCGGAGACACCGAGCTGGAGCCCGAACACGAAGATCTGGCGAGAAGCAA
CTCGGAGATGACTGGGACTGCAATGACGAGAGCCAACAGCACGCCTAGCGCTGCGTTGTGGTACACGCCGGAGAGGAGTCTGCATCGATCACTGTCGACA
CCGGATCATGCAGGACGCGCGCCGACGCCCGAGTCGAGTTCAAAGCGGCTCCAAGACTCGAGTAGTACGACCCCTGGTCGATCAAAGCGCGTGCGACTAT
TGGGTCGAGGGGATCATTCGAGTTGTCCAACTCCAAAGCTTGACCTTGATCAAGTTGACGGCCGATCCCAAGCTTCAAAACCTTCCTCCACCCAGCACGA
TACGCTATCGAGAACAAACTCCTTCTGCGAAGCCTCCAATCCAGACGGCGTTGAGGTCTCTTCGTCGCGTCTTGTGAAGAAGCCGTCTCGACGCCGTATC
CCGTTGGTTCCTACTCAACCTCAACCACCTCAACCTGACGCAGCGAGCGAGGCAGCAGCCGACGGTGACAGCGTTGGCAACCGGGTGGCCATCGTTCTGA
CGGGGTTGGAGCCGACGGCAGCGATCAGAAAGCAGATCAAGGCCATCAGCGGGGCGACGTACCACGACAACGTGGAAGATGCGACCCATGTTGTCGCTCC
GAGCAACCAGCTGAAGCGCACCGTGAAGCTTCTGTGCGGGATCTCGCGCTGCGTCCACATCCTGGACGAGAGCTGGCTGGACGAGTCCGCTCGGGTCGGC
GCCGCGGTCGACGAGAAGGAGCACTGCCTGGCCGACGACACGGCGGAGGAAAAGTGGCAGTTTTCGCTGCGGGACACGATGTACAGCGTCAGCCTCGAGC
AGCGCCAGCAGCTCTTCGCAGGCCGCCACTTCTTCATCGTGAACCACAAGTCGGTGCTCCCGCCAGTGAAGGACCTCGTGAAGATTGTGGAGTGCGCGGG
CGGGACGGCGGCGTGCAAAGGTACAGCAGCAGCAGAGGACGTCGTGATCACCACTGAAGCCGCGCTCGGCGCCGCGTCGGTGCAAAAGGCGCTGGCCAAG
GCCAACTCGGAGCGGATCTACTCGCCGGAGCTGATCCTGACGAGCATCCTGCGGCAAAGCGTCGACCTGGCCCAGCACCGCGTCCACCTGCCGCGCAGCA
TGAAAGGGAGACGGTCGAGATGAGTTGGGGTGGGTTGATGGTAGTAGCGAACTGATAGACACATGCGTCGTATGGAGCAGCACGACTTATTTATTCGGTA
CATTGGCTCGTGTGGAGACGGCGGGCGGACAGCGCATGCATGGGCTGGCTGGCTAGCTTTCCATGCTGTCCGTCCCGATAAAAAAATAATAATTACTGAG
GCTACGGGTGGAACGCGAGTGCGTTCCAGCGCTACTTGGACGTCTGACGTAGGCCAATCAGGGCACAGCCGAGCAACGACACGACGCAGACCGAGACGAG
GTGCTGGCGCGCCATCGCGTCGGCGATCCAGTCGTCCAGGCTGCTGCTGCGGCGCCGGTGCGCCAGCTGCTCCGAGACGGCGTCGCGTTCGAGGTCGCAG
AACTCGGTCGGCGCCTCGTGCGGACAGTACTCGCGCATGTTGTGCTGCACCATAGGAAGAGAGACTCGGTCAGTCAGACAGTCCAGCTATTAAGAGATCG
GCGGCACCGAGAAAGGCTCCACGCACCAGGTCGCGGCCGTGCTGGTCGGCGAACGAGAGCGTCTTCTTGGGCTCCTCGCCGAAGCGGACGGTGATGCGCC
GCGAGGTCGACAGCTCGTCGAGCCGCGAGCCGACCCGGCCGCCGTCGCCGCCGCAGTACGCGCTCGTCTTGCGCAGGCACGAGCGCTGGAACGGGTACGA
GTGGCGGCGGCGTGAGACGCGGCAGGCACTGACCGCCATCGCCTGCGCCTGCTGCTTGGGCTGCGCGAAGGCGGCGGCGCTGGCGGCGGCGGTGCCAGCG
GNNNNNNNNNNNNNNNNNNNNNNNGCACGGCGGAAGTCATGCGCACTCGGTGGCGAAATCGCTTCTGAGCTGGCGCGACCGCCGGTGGCGAGCCAGGCCA
AGTAATCAACCGCAGGTGCCAGCGTCGCGTCCCACTCGTCTCCTCGCCATTTACGGCGGCGAATTGCGGCCTGGCCGGCCGACAGTTGGCTGTACCACAC
GGCTGGGTACAGTACGGCGCCAGCCGAATTAGCGCGCCGAATTAGCGGGCGGCGGGTGCGGAATTATTACCGGTGCGTGGGCATAGAAACGAGATCTTTC
GGCCCAGCGGGGCTCTGCGCACTTGAAGTTGAGCAGGTCGTAGCCCGAATTTTATCAGAGCGTAGGGAAGGGGAAGGGCAGGCCACGGAATGGCCGACAG
GCCAGATCTGATTCGGCACCGCCTGAGTCGCGGCCTGCGAGTCGCTCGCCGCGACCACAGCGCCTGGTTTCACATCGGAGATGCTCTGCAGGTTGGCTAC
CATGTCCAGAGCCGTGAATGTGAGAGCTTTGCGGCCTTGTTGTCGCTG