Description :
From Genome Similarity Track
Location :
Scaffold_144:5949- 17718
Transcript NameFunction/comments
Phypl_g4108replication factor C subunit 4
Phypl_g4109vesicle coat complex COPII subunit SEC13
Phypl_g4110hypothetical protein
Phypl_g4111hypothetical protein PHYSODRAFT_309136
Phypl_g4112hypothetical protein PHYSODRAFT_353495
Phypl_g4113conserved hypothetical protein
Phypl_g4114conserved hypothetical protein

Sequence
11769 bases(100 bases per row)
TTAATCGAGGTTACGTTGTCGGAGTTACCGTACACAACTTTGGCGCGAACCACGAACCTTGGGATCATCGGTCATGTTCAGCTCTACATCGACGTCCAAA
TCCAGCGTCCCAGCGCCCGTGCTGCCCTGGGTGGAGAAGTAGTGCGTGCATCATCCGTATCTGCGTCTTTCCTGTAGTGTGCACAAGTTTCTAATGGTGA
TTCCTCGCTGTTGCTAGTCGTCCCAAGaacgtggacgagatctcCCACCAGGAGCACGTGGTGGCCACGCTCAAGACGTCCATCGCCAGTGGCCAGCTGC
CTCACTTGCTGTTCTACGGACCTCCgggcacgggcaagacgtCCACGATTGTGGCGGTGGGGCGCCAGCTCTTTGGCCCGGACTTCCGCAAGAGCGGGCG
CTTCCTGGAGCTTAACGCGTCGGATGACCGCGGCATCAAGGTGGTGCGCGAGAAGGTCAAGAGCTTCGCCCAGGGCgccatcagcagcgccagtgGCCTG
CCGCCCTTTAAGATCATCGTACTGGATGAGGCCGACTCCATGACGGGCGACGCGCAgtcggcgctgcgtcgcATGATGGAGAACTACTCCAAGGTCACGC
GCTTCTGCCTCATTTGTAACTACGTGAGTCGCATCATTGAGCCCGTGGCCTCGCGATGCGCCAAGTTCCGCTTTGCCCCGTTAGAAAAGCTCTCCATGGC
GTCTCGTGTGCGCTTCATCGCCTCAGAAGAGCACGTGAGTGTGTCGGATTCGGTGCTGGAATCGCTGCTTGAGTGCTCAAACGGAGACTTGCGTAAGGCG
ATCAACTACCTGCAAAGTGCCAAGCAGCTTTGCGGGGACGATGAGCTGTCCCAAGAGGATGTTATTGCTGTGGCGGGCCTTGCTccgccggagctgctgc
agcaatttTGGGCCTCGGTGGCTTCGAACAGCTTTGAAAAGATGAAGACGGACATCGAGAGCATCCTGCTGGCTGGATACCCGGTGCTTACGATTTTGCG
GCAGCTgaacgacgacgtgctcgcACTAGACAAGCTCAATGACGtgcagaaggccaagatcTGCCTGCGTATTGCTGAGGCCGATAAGAGGCTCGTCGAC
GGTGCCAGTGAGCACTTTCAGCTGCTAGACGTCGCATCCTACGCCATGCGCGTTTACCATACGGCGTAATAGATGAAGGAGCTTGGTATGACAACGATGC
ACGCATAAATAAAGTGGAACGACGATGATGAATGGACGCATGCACAGAAAAGTTCCTAGCATTTAGAAAGAAAGCAGAGACCGTAACAACTCCGAGTCGT
GATGCCAATTGGTCTTGGTCAGGTATCTAGTTAGCTGCACCTTGATCAGTTACAGAGGACATTTGCATCCACTCATGgttgctctgctgcttccagaAGG
TAACCTCATCATCACCAACGGCGGCGCTAAGAACGGAGCCCGTGAGCGACCAGCTTATTCGGTACACCGGTGCACGGAACATATGCACCACATGGGGCAC
CCACTCGCCATCAGTCTCGTCTTGAGTCCAAACACGCACCGTGTGGTCATCCGATCCGGACGCGATCACATTCGACGGGATACCCACGTTTGGCGCCCAA
GCCACATCGCGAACCCAGTCGTTGTGTCCGTACAAGGGGGTATTCACAACTTCCCAGTAGCTGTTGCCAGGGTTACCACCTTCCTGGGACGTCGTAACAT
GCTGCCAGATAGTAATTGCGTGATTACATGATCCAGTGACCACGCGCTGGATTGGGCCTTGAGCCCCTTGCGAGCCCAACGAGTTGTACGGAGCCCAGCT
CACGGACGTGCAGCCCATGCCCTCCTCCGAGTTGCGGAAGCTCGACGAGACCACCCATCCTTCACGCATACGGGTAAGGAACGATACCTGTCCATCGGCC
GAAGCACCAGCCAGACAGAGTCCGTACTCGTACGGTGCCCAGGCCACACTGAGCACAGCCAGCGAGTGGAAGTCGTGCACGTGCTTGAGACGCCATTCCG
TCACGTTGTCGACTCCACCAGCGCcctgctggaccagctcctCTCGATAGATGTACACTTTTCCGTCCTGCGCGGCCAGAGCCAGCACCGCGCCGAACTT
TGGGTGCGCCCAAGCCACGCGGTGGATGGGGGCCGCCGAGTCGTCGGTCAGAGgcaccacgtgctgcagcacgtgatgctgctgctcctgctgccgtTCC
TGCCCGTCCTTCGCCGCCGAGAGGTCGTCGCTGTCCCCGCCCGCCACCACGGCCTTCGACACGTCGTACACGTGGAACGTCCGGTCGGACGAGCACGTGA
CCAGGCGCTTCCCGTAGTAGTCCAGCTGAATGTCGTAGATCATGTCCTTGTGCTCGGTGTCGATGCTTGCCACGGGCGCCTGACGcggctgcatctgctg
ctgctggggatgctgctgctgctgttgaaggGGGTGGGGCTGTCCGTGCGGTGCGGCGAACTGCCCGCTCGCCGGCGAGCCGTGCATGCCGCCTGCGAAC
TCCATCTTCCTTGTCTCCGATGGCTGATGGCCGAGTGTGCGCGGATACCAGATGCGAGACTATTTGCACAAATTTGAGTTGGACCAAATTCATGGCCAAT
TCTCGGAAAGGCAACTTTACTGTGCGATGTTCGCTGTGAATGGGCCGAGTGGTCCGACGtcgcgccacgagcaccgcGTTAAGAACGACCGACAgcgaga
ggaagaggaggagaccaggagacgctggactGAGAAGAAGAGAGAGCATTTTTTTCTGGAGAAACGTGCACAGGCGGGCAGCACCGAGCATGGTCGTGTG
CTGGGGTTTGTAAAGGCAAGTGCAACATCACTGTTAACTCTTACTGTGTGCTATACAATGCAACAGATAAAGAGGAAGCGAAGAAGTTTGCAGCACAAGC
ACGGTTCGATATCTTCAAGgtacgctgctgcagaacggTGTGTTGCGTCGGGTCGTAACTCTCCGGTTGACTTggctcctgctcgtcgacaGGGATGCCG
GGTTGTATTCAATGGGCGCACAGGCAAAGTGTCTTCGTACGTACAAAAGGAATGTGTACGTTGCCTATTGACCCTGACACCACATCGCTTCTGTTTCGTA
GATACTACttggcgaagctggtgcaggagcaCGGCGGCAACGTGGCGTACGCAGAAATTTGCTCAGGATCTTGCAACGTCATTTCATTTGATGACAGTCC
TTGTGTTGCGGTTGGTATTGCAGCTCGATGCTGGCCTCCACGCGCGTCACGCACATGGTCGGCTCCAACTTGAACGGGTCCAAGGCAGACAAAGTGCTCA
AGGTATGTTGCTCGAATTTACCCTGCTCGCTACATGGAGATGTTGATCTAACCTGCACCTTTTTGCCTGGACCAGAGCTCTGGCAAGGTCAAGTTTGTGA
GTTCAGGTAAAGTTCCGCCGTTCTTGATTCGCACTGCTGTGTCTGTCATCTCAAACACACTTGCTGAAATGTCATTGCGCAGAATGGATCCTGCAATCTG
TCAAACGCAAAAAGCGGCAGCCTGAATTTGAATTCCTAGTCTACAAGGATTCAAATGCAGCAAGCTCGCTCCACGCTGCATTTTCCCGAGCTGCTCCATC
AACGAAGTGAGGGAAGACTCTGCAGCACACTCGCTTCAGTTGATGCATTAAGGTAGAAAGAAACATAATTGTAGAAAGAGAAAGAATATACCATGTATAG
GGTCACAACTAACCAGAGTAGCATTCGTTGTCGCTCCTTTCAAGCCAAAAACGAGAACGCGAGACCTAGCAGAGGAGCGCAGCGCTGACCTGAGAAAGCG
CAACCTCGTACTCCTCCAAACGCCACCGAATCCTCGAACAGCCTTTTCACCCGCGCCGCACACCAGCCTTTTATCTTTACCCTGTTCTGGACCTCCCGAG
TGCCGCGCCTCTCGTGCCTCGCTGCACAAGACTCCGGAACTAAACTGCAGACAAATCAACTAGCGCGCGACGCGAGGCAAACAGGACTAAACGACACTGC
TTAGCAGCACTTCGACCCGCCGTTGGACGGAACCTGCTGGCCGGGCGTCAGCTTGACGCCGGCCTTGGGGGCCACGGGGGCGTTGgccatgcgcttcttg
atcTGGGCAGCCATCATCATGAAGGCCTTCTCGACGTTGGCGGCGTTCTTCGCACTGGTCTCGAGGAACTCAATGCCCAAGCTCTCGGCGAActccttgg
cggcgtccgTGCTTACCACGCGCTTGGCCGTCAGATCGCTCTTGttgccgaccagcagcttgttcacGTTCTCGCAGGCGTATCTGCAAGTCACAGCGGC
ACATCAGTTAGCTCCTTTCCGTGGTCCTCCTTGGTAACGCTAAAGTCCAACGCACCTATCGATCTCGTGCAGCCACTGCTTCACATTGTTGAACGACTCC
TGGTCCGTCACGTCGTACACGACAATAATGCCGTGGGCACCGCGGTAGTAGCTGCTAGTGATCGTGCGGAAACGCTCCTGGCCGGCCGTGTCCCACTGCA
GAAGCACACGTGAATACCGCACCAAGTTAGTTAGATGTCCGAGCCATAGGCTACAGCTCATAAGCGGTGAAATCTTAAAGCGGACGTACAATCTGGAGCT
TGATGgtcttgccgtccagctcgatcGTACGGATTTTCTGGGCACAGATATTACCACGTCAGCAATCCTGATAAGAACCCGCCCTTCCTGCCCTCGAAGG
CGCTAACTAGGGAAGAGCCGATGTGTCGGAGGCACTTACAAAGTCCACGCCGATGGTCGAGATGTAGCTCTCCGTGTACGTGTCGTCAGCGAaacggagc
agcagacacgACTTGCCGACGCCGGAGTCACCGAttagcagcagcttgaacaggTAGTCACTGCACACAAAAAGCGAGCGTCAGTCGGGGTCTGGGcttc
gttcagcagcagtaaATCAGCTCCTTGCGTGTGGCCCTGCTGCACGTACTATTCCGGGTTCATCTTGGTCGAATGTGGGGAGAAAGCGGCGGGTGAAGGC
GCTCAATCTGCAGCACGGCACAGCGATCGGTCAGTTCACGAGTTGCCACGGCGGGGCCTGGCGTTACGCTCCCTCCTTGCTCCCCCCTTCCGCGGCCCTA
GAATCCGAAGAAAGATCGAGGATCCGTCCACTTCGACCAGCCGGTGCGGCGGGGGCAGAGGAGCGGCGGAAAGGGGGAGGCCCAGGGGGagagcgcgccg
ccgcagctggCACAGCATTCGTCCTGGGACACCTACAcagagaagaaggaggaggcggctCGCGCGTTCTGAGCGTCTTGGGTTGTGTCGCGGTGGTCCC
TACGGGGTTTCCCCGAGAGAAAGAACACGAGCCGCCGTTTTGCCTGAGGTTTTTATTGGTGAGGTTTTTCCGgcatttcagccaatcagaagACCGAGCG
TGGCAACTGGTGTGGCACACACAGCCATCGAGACATTTTGCTgccgacgacgttgaaggcGCGGCCGAGGCAAGGCATGAAGAACAGTCCCGCGTGGCGa
atcctgctgcagccgtccGTTGCGTCAAAATGCGCGATCGCTAGCGGGCTGGCTAATTATATGCCAGCGAGGTGAAAACCGAAACTGGATTGACTGCTGC
GGATGCAACTCAAATCGGCGGCGCGTACTGGTAACGGACACTGCACCCTGGGGCATTTCGCTtggagtcgctgtcgccaTGCAGGCAATTGGCCGAGCGG
CGTCATGGCCGAGTCCGTCGCCTTGTTTGCAGTGCCAACAAGAGggagcgcgctgctgcaagcggCGCTTGGAGGCTGCTAGAAACCAAGTGGTCCCCTT
TTGCCTCCGTACCTGGCCGGTGCGTATTGAAGAGGGCCTAATCGATCGCAGATTCTCTTCTGATTCATCCAGAATGAAGGTCTCTCGTCCTCCCTCTCGA
ATCGAATCCCCAAGGGTTAGGCGTTCCGCCTTCGGGCTTCAGTCCCCCCACTTACACAAAGAAAGTAAGCCGAGAAGAAACGTCGAAGGCAAGTAACCAG
ATCgtacggcggcggcgctcgcgctcgccgcgctgcgccacctcggccgTTCCCTGCGTATATGTGCGCTCGTCTGTGTGTTGGTCGCGCAGCATTCGCT
CGCGTCTCTCGGGTCGCTCTACGGGGCGAGAGGGCGCGAGTGACGCTGGCTCACCCCCGCTCGGAATCAGACGTGCTTTTGCGCCTGGATTTCAGTGTTT
GTTGAGGGTTGCAGCGCGCCAATTAAGAGTGCTAATAGTGTGCAGCGACCTTTCATGGCGAGATACCGTGTCCGGAGCGGGAAAGAGACTGACTGGAGGC
GCCTGTGTGTCGCTGTTTTGCCTGTGCTGCAGACGTAGCTATCCCGGAGACTCACttgcaagaggaagaacaCGCCGACAGTCTTTTTCGCAGCGAcgat
gagctcgttcaaGAAGGAACACCCGTTCGGTACGTGGCTCTGACGGTCTCCGATACAGGCGGCGAGAAGCGAGTGCTAACGACGTTTGATGGTGTCGTGT
TTGCAGAGAAGCGCCAGGCCGAGGCGCAGCGCATCCGATCCAAGTACCCCGACCGAATTCCGGTGCGTATCCTCCGAGTCCCGCAGTCATTCGAGCGTAG
TGTACCATAAGCTGATGGGCGTGTTGTTGCGTGGCTGTGGTGCAGGTGATTTGTGAGAAGGCGGACCGCAGCGACATCCCGGACAttgacaagaagaagt
accTGGTACCGGCCGACCTGACAGTCGGTCAGTTCGTGTACGTGATCCGAAAGCGCATCAAACTGAGCCCTGAGAAGGCaatcttcatcttcatcaacaA
CGTCCTCCCACCCACCGGTACGGGCTTCGGTGCTGGGTTCACTACTGTGTGCTGCTCGTACTTACTCCAATGCCGTGGTTTTGTTTCCGTTTGCTCAGCT
GCCTTGATGTCGAACATTTACGAAGAACAGAAAGACGTGGATGGCTTCCTCTACATCACCTACAGCGGCGAGAACACATTCGGTCAATAGGGTGCACGTG
CTGTCGGCGTGTGGGGACTGGATTTTGGTTGAAGATTTTttttcgtcgtcgctgtagtgGGCTGCGAGCCCCGCACTTTCATGTTGGgagcggcggtgct
gctttTCAGAACCAAATACTCAGGCGTCGTCTTCAGGAAGAGCTGACAGCAAGATGAAGTCGGTTACTGAGGGAAGCTGATCAGACACAGGGCACTAATC
CAAGCACGACAAGAAgtatttgctgctgcgtgtggTCCATTCTTCTAAAGCTGGCGATGTTGATATTTCCTAGGAACAAAACCCCAGAAAAATGCATGCA
ATTCTATTCAGTCGCTCGTGGTCCCTCTGTGTTGTTGCTTCGACAACCTTGCTCAAGCTGACGCCGCCCTACTCGCGCTGGAACTGCATCATCTGCAGAC
CTTGGCCAACGACAACAACTTCATCGGTTGTTCCAGCCGGGGTTTGGCGAATCGCGAGATCAGCAATGTCGGCGCATTCGGAAAAAACAGCTCCTTGCCA
CTCCAGCCCCGTGCCGCTTTCGTTGCAACGAACGTTCCACTTGCTCACTCGTTGGTCGTATCCGGCGGTATAAATGACCTCGGCATCCACGCAAGCAACA
GTTTTAATTGCTGAGCCGCTGGCATTCACCGCCCGAGCTTCAGATATCATTTGGCATGCTGGGAAgcgcagctcacgcagaTTCAAATTCTGGTCGTCCC
CACCGCTGATAAGAGCCACGTCAAGACTTCCTTCTTCCTTACTCTTTTTGCAGAAGACCAGATTGATACAGTTCGCACCCATATCGTGTGCCAAGTAGTT
ACCACTCGGTTGCATCTCACCAATCAACCCCTGAAGCTTTTCCTTGAACAGCCCCGCACCTTCCTCGGACCGAAGAAGCAAAGCAAttttcttcagcagc
gcgctgagGTCCCACAGCGTCACTAAGCCATCAGTAGAGCCCACTGCCAATCCAGCAACTACTGCATCCTCATCACCTTCCTGAAAGCCAACGCAAGACA
AAATCGGCTTTCTTGAGGACGAACGGCAGTCGCCGAGCTCGAAAAGTTTGCCGTGGTTCACGTCCAACAGCAATAGTTGAGTGGATCCCTCGGAATTACA
AGCCGCCACAAGTCGATACGCGTCCGAAGCAGAGGGTATCGCAAACGTAGCAAGCCCGAGAATGCGGTGGTCCTGAGCTGCCTCGGCAGGTTCCTGGCCG
CAAACATGGCGGAGCAGGTCGCTTTCTCCGCGAACTAGCCACACATTTAGACGCTGCTTGCCACCTCCTGAGATAATGATGTGGTCCTCGATGCCATCAG
AATTTTTGCGCTGGAACGTTGTGAGCGCCCGAACAGTAGTCGTATGGGCAATTCCAGAAGCCACACTGCCCCAACGAAAGCTTGTACGCTTGTCCTGATC
ACCGTAAGCGTGCCGGCGATGTAGTATGAGGCTGTTATCCTCTGCAGCGGTAACTAACCGCATATTTCCGAGGAAGGCCACGCATGTCGTCATGCGTCCG
TGATGATGATCGTGCAGTGAGCATTCGGAGAAACGCGTGGAAGTATCGGCAGCATTGGGCTCATTCAGAAGAGTCGAGTGCACCTTGATGTCAACCTGCT
GCTTTTGAGTTGCTGGGGGCGTGAACACAAATGTGTGTGAGGGCAAGGCAGAGTCGAGCTCACCCGCTCTAGTGAACAGCGCATGTGGGCGGCGCCAACC
ACCACATTCCACGTTGAAGACACGATATTGCGCTGAGAAGTTGTGCAAAACGGCTTGTGCCGCGTGGAAACCAAAGACCATGAGATCACGCTTTGTCTTG
GCGTCGAAAGTTGAAGCTTCACCCCACCAAAGCTGCTTGATTGTCGAAATTCCTCGAATGGACTCACGGCCTACGTGTACAGCTGTCAGAACTCCACTtg
catcttcttccagcgcatACGAGCAAATGTACCCATCATGTCCTCCCGACAGCATCACGGTATGAACGCCTTCATTTTCTTCGGAAAGCAAGAGTGATGC
CACTAATTCACGTCCGTGGGCACCTTTAAGCACGAGAGCTGGGGGTCGCACCGCCTTGGATTGTTCATCACTTTCCCTCGAATTGAGTGAACGGTGGAAC
ACATACACGCTGCCATGTCCGTCGCCTGCTACGATATTTCTGGTCGTAGCCAAGCGATCGACCACCAGAATTGAAGATGTTGAGCTCTTGGCAGGGATCT
TGAATGTTGCCACAAGCTCCATTGTGATCGAAGGCGATGCCAAGGTCTCGCTGGTCTCTGCAATAGTTGGTTTCCATTCAGATAGGATGCCGTtggcact
gctgctgaaAAGGGCGTCTTCCTGGTCCCACCAAAGCTTCATGATTCGTACGTTGGTTTGGGTAGACCACGAGAGCAGCAGAATGCCCGTGGATGCATCC
ACGATACACACTCGACCTGTTACTTCGCCtagcagcaagaagcgcccAGAAAAATCCATTGCGAACGTCGACAAACCGCCAGTTGGAGGGATCGTGAAAA
ATAGTTCTGTTGTGAGTGACGACAAGTCCAGACGGAAAACATCGCCGTGCTCGGAAGCTACAAAAGCCGTCTTGCCGTTGTCCACAGTGCTGAGAACGAT
GTTACGCACACTGTGTGAAGATGGAGCACCCTTCTTCCTTTTTACTGCAGCGGGTGTTGTCGTAATAAGGACACGAACCGTCTTACACAAGTCGCTAGCT
CCCGGCGCATCAGACGAGGACATGAGCTGGCGCGTGATGTCCCAGAGTTTAACAGCACCGTCACCGCCGCCCGAGGCAATCATATTTAGCGACGGGTGGA
CAGCTGCACGCCATACGTGCCTGCCCATGTGACCTTGCAACGTGGCAGCACAATTGCCTTCAAGATCCCAAAGCTTGCAAAGGCCATCCTCGCTCGCCGT
CACCACACCGCGCGCCCAGAAGGACACATCCCAAATGCGTGCCGAGTGACCCCATGCTCGGAACACTGGAGTGTATTCAGCCGTAAGCAGTTCGGCACGG
TTCGACCTTCGTGGCAAGTGGAGTTGTTCAACCGTAGTTTTTCCATTGTTTGACCACAATTGCACTGTACGGTCGTCCGAGACcgaggccaacaagcgcg
CATCCGATGACCAAGCCAGCTTGAAGAGCACACCATCGTGAGCATGCAGTCGTTGCGCCGGCTCAATAGCAGTGTTCGTCTCTTCACCTCCATTTTCCAT
CGGATTCCACAGCAGAATCTGCTGGAACACCGTTCCTGAAGCAGCCACCAGGTCGTCCATCGATCGTCCGTGAAACGCCAACGCGTACAGAATGCAGCGC
TCGGCACTCTGCACGCTACGCAGAATTTCGTTGCACACAGGGTCCCATATCTGCACGAAGTTATGCGCAAGTCCAactgcagccagcaggtTCTTGTTCT
CCCCCGACGCAAAGTCAcccgtcagcagctgcacgtcgaACACCCAGTCGCAAAACACTTTCGGTTTGCCCaacaccgccagcgcctcgagccaGCGAGC
AGCCCCAGGAGTCTGCGGCAAGTTCTGAAAACATGATGCACGTTTTTGACCGAAGAATGCACCGGAAAACGATTCCGTTGCAGCATCAGAGCCCGGATGC
CCGACGATGTCACAGCCGTGCAGAATGCCTCGCGTCAACACGTCGTGCTTGCCCAGAATCTCACCAGTAGCGGTGGCGTACAGGAAAACCGTCGGGCCCA
CGCCCACGTAGAGTAGAGATCCATCCGATGAGAAAGACACGAGCGTCACGGCGCCTAGGAACTCCTGTTTCTTGATCGGCGGGtgcgccatggcggcgtc
aGGCGATGGGGAGCGAATGGTCTGTGATTGGCAGAGACTACCGGTACTACCGGTATTTTGCTAGTCGTGGTGGCCGGGTTgcacatggctacactttgTG
GACAATGTTGAAGTAGTACATTGTTGCTAATAAGTTACTTTGCGCAGTCTAGGCCTCGCAGAGGACGCTTTCGGGAGCTTCAAGAGCGATTCGCCAGCCG
TCTTCTAGTGGCACGGGTGGTTTGGCAGCCCGTGGTCGCTGTCGGGGtctttcttgctgctgctggaactcgctGAGCTTGGAGAACACGggcttctcca
tctgcagGACTTTCCACACTGAGCGAGCCTTACGAAACTCGATCTTGCTTTTGCTCGGGTCCGAGACGGGCGAAAAGTTATTGGGCTGCAGCGCccgctc
cagcgtcttcaagGTAAGGTTGGCAGGAAGGTCGGCGCCTTGaaggaagaagccgcgcacGATCGGGAAGATGGTGTTGGCGCAGGAAATGCACTTGGGC
ACCGCGGAAAAGGTGTGCGATGCCAGGATCAGCACGAACTGATGGAGTCTGACGCGACGCTGGTTGATCACGTTCGGGGACCGCGAGTGCAGGACGCGGC
GTCTCGGGAACCAGTagctgcgcagcgtctgAGCGAACCAGGCACAGCCGAAGCACTGCGACCGAGCACCGCCTCCACGGCGCAGGAAGAAcgcgtgcag
caccttcagcagctcgcgaaATTCGGAGTACCGACGCTCTACAGACCACTCGAGATCCGTATTGGCAagcgagcactgcagcacgtaCTGGGTGATATCG
CCCATGCGCGTGCTAGGCTTCACAttcgccagcttcaccacgAGCTTCGGCTCGAGGCTGTCGGCTCGGCAAGCGATGCTCGAGTGGaagcagtcgtcgt
cgaggtaCATGGCTGCGCTGCCGACACACTTGTACTGTACAACGTGAGACCAAGCGAAATGCGAAGTAA