Description :
From Genome Similarity Track
Location :
contig_38:59488- 64019
Transcript NameFunction/comments
g8310.t1hypothetical protein
g8311.t1POM72399.1 GPI ethanolamine phosphate transferase [Phytophthora palmivora var. palmivora

Sequence
4531 bases(100 bases per row)
ACGACAAAAGCACTCACGCGCAGCAACAAGCAGCTCTCTTCTGCGTAGGAAGTGCACGCACCGCCCCCTTGGCGATCTCAAACGCCGTAGACACCGTATG
TCCATGAAATAGTGACAGGTAGAAATGCTTGGCAAACATCGTCGCCGACGCGTCGACCACCAGTGAATCCGAGTGCACCGCCACGACATGCGGGATGCCA
GCGTTCAAGAACACCGACGCGACCTTCTGGCTATGACACGCGTTGACAAACACCAGCTGCACATTGCATCCAGCGGTCTGGGCACAGCAGCAGACTTTCC
CGTGGTTTCCATCTCCACAGGCGCAGCCCCCGGCACCTGCTGCTGTCGATCTCCAGAGAACATCAACTGCCTCAACGCGTCCGGGGTGATGAGGTGCGTG
CACCCCGCCCCATCTTCAAAGCAGAGCGCCGCACGCTGACCCAGTCCGTGGCCGGAAAAGTGCAGCACCGTGCACTTCCAGGCCGTCATGAGGCTGCGCA
GAATGTCCGCCGTGGCGATGTCGAAGCGTACGTGGATGGCCTTGTGCTGTACATCTGTAAGCAGCGAGTTGCTGATCTCGCGCCGCTCTGCCTCCAGGTC
CAGCTTCTCCATGGGGTAGATGCGGTGGCGACTGTCCTTGATCACGAGCGGCGCCGCGTGCAGCACCACCAGGTCCAGCGCGTTCTCGTCGCGCGGCAAC
CAGTTCGGACTCGGCTGTGACGAGGCAGTTGTTGTTGAAGTTAATGGAGCCGGTGCTGAAGATGACGTAATAGCCTCGCTTGAAGTCGCAATCAGCGCCT
CGAGCGCCTGGGAGAGCCGCACGCGGTCCCCGAACGCCGCGATGCCCAGGTCGTCACGCAGCGCGTTGCGTGTGAGCTCCGGCAGGATGGCGCCCGAGAT
CTTGTTGGCGGCGAAGAGCTCCGCGTGCTCGCCGAAACCCTGCGCGCCCAGCCACTGGACCACGTCGGCGCACGACCAAGCGCTCCAGGGCGGAGCCGAC
ATGCTGCCTCCATTTTGAAGTGAAAGTGAGGTAGTCACTAGATCAGCGGGATGAATCCATACTGAAATCAACAAGGCGTGTGTGGAAAAGACTGCGTTAT
TAGTATCAGATCTGATTCCAATAGTTGCGGGTTCGGGCCATCCATTAGTGGAGCTGCTCATGGCGACTTCGGCAGGAGGCAAGAAGCGGCCGCGTGCCGA
CCTGTTGTCGTCGCTGGACGCCGCGTTCGCGTCTACTGCGCAGCCTACAGCGTCTAAGTACACGACGCAAGCGGCTGCGCAGGCGGCCCAATGGCAACAA
ACAGCAGGCCTACCAGCACTCGAAACGGAAGCGCAAGGGCGGCAAGAACCACGACAAAGCTGGACACGCGCGAGGAAATGGCAGGGAAGCAGCGAAAGAA
CAGGAGAATAAGAGCGAGTATAAGGTTGACCCGCTGTATGAGAAGATGGACGCGGAGCTGCTGGCGGTTGGGCTGAAGGACTGCTCGCTGGTGAGGACAG
AGCTGTTAGGTTTGGTAGTTTTGATGAGGTGCTGACGCGTGCTTCATTTGTGGTTATTGCAGCACCCACAAGCGAAAACCTTGACGAAGTCGCGGGCATT
GCACGAGACATTCAAGAACTATCTGGAGTCGGTGGTGCAGGGAACAAGAGCAGGTTCTACTGCTGTGGTCAGTCTCAAGAACAAGGTGCTGTCCTTGGAC
AACCCTTTCAAGACGACAGCAGCGGAGACCTCGGAGAAAGCAATTACGGCGGCAAGCAAGAAGCAGACGGCCAAGCTGCTGAGTGCGAGACGGCGCAGGG
AATTGGGCCTGCATCTGCTTAGCGGGAACATGAAGTACAGCGATGCGATGCTGCTCAACGATATCTGGACGAAGTTTGTTCGCCAGATTATTGAAAGCGA
GGTGGGCGTCGTTCAGGACGTAACGGTCGAGGCGCAGCGTACGCGAAACACGAAGCTCCAGGCTAAGCTCAAGTATCTGGATCTTTCCGGGTGTCCACTT
GAAGGTGCGTTCGGTAGACAGCTGAGTTCCTCGTCATACAACTGGGACTAACAATGCGATCGTTGTTCTTTGCAGTGATTCAATCGCAGAACCCGTGCAA
GGTTGGCCTCAACGGGATCGTCGTCGCGGAGACCCAACACACTGTTCAGATCTGCTGCCTTGCAGCTACCGGAGACGACAAGGACGACGGCCCTATTCGC
AGTACGTGCACCCACAAGAGTCGAGTCGCCCATGCTCCTCACCCAACCACTTCTTGTCGTTGCTAACACCCACTCTCGTTGGTGTCCACAGCTTTAGTCA
AGTTAGATTCGCGCTTCAAGGTCCGCCTCGACTCCACTCGAACCTGTTCCTCGATGGTGCGTGGTTCGCTGAGCGTGCACAATAGACAGCACTCTCATCC
GCTTGCTCAATGGCATCACACCCTTGCGCCGTTTGATACACCAAAACCAAATTGTCGTGTATCCATCTCACGAAATAAGAGCATAAATACTCTCTCTAAC
CGCTGGCAGTTAACTTTCGTCGATTCGGAGGTCGTTGCTGGCATGGGCAACATCGCTCGCCTGCTGCTGCTGGGCGTGGCCTTCCACGCACTGTGCATCC
TCAGCATATTTGACATTTACTTCCAATCGCCCGTGGAGTCCTCGATCCCCAGTAACGAGTACACGCTGACGCCTCCAGCCAAGCGGGTCATCATCTTCAC
GCTCGACGGTTGTCGCGTTGACAAACTCTTTAAAGCGGTCGCAGGGTACGCAGACCGCTACGATCTCAATGCGGAGAGCGCCTCGACGACCACCAAGTTC
GCTTCCAATAGGCGCACTCCGTACCTGGGCGACGTAATGCGCAATCGCGGCAGTTGGGGCGTCTCTCACAACCACGCGCCGACTGAGAGTCGACCGTGCC
ACGTGGCGTTGACTGCTGGAATGTACGAGGACCCGCACGCAGTCACCAAGAACTGGAAGCAGCATCCAGTGCCCTTTGACTCGGTCTTCAATCAGAGCAG
TAGTGCCTTTATCTATGGCAATAAGGATGTCGCTCCCATTCTGGCAAGACACGCCCCGCAAGCGACGGAAGAGCACTACACGGCGAAAGAAGAGGTCGAT
ATAATACGGGAAGACACGACGCTGCTGGATGTGTGGGCGTACGAAAAGATGAAGGATTTATTTGCACGCGGAGCGGAAGCGAAGGATCCAGATTTGTACA
AGAAGCTGCACCAAGACAAGTTGGTGATTTATTGTCATTATCTGGGCACCGACTTGCGGGACCCAAGTTTGGTGCTGATTCGAGAGAGTATTTGGAGAAT
ATTGCGGTGGTGGATGAGTTGATTGAGAAGACGGAGAAGATGATCGATGCGTACTTTGGAAACGACAGACGAACGGCGTATGTGCTGAATTCAGACCATG
GAATGGATCTCCGTGGTGATCACGGGGATAAGGATCCATCTAAAACGCGGACGGCGATCATTGCGTGGGGGGCAGGTATCCACCGTCCTGTTGTGGTGAA
TAGGACAGGAGATGAGGGTTTTGATTTTGACGTGCCTACACAGTCTAAAGCTGAGGTGCAGGTACGTCTGGAGTCCCAGGAGACTGAGGAGCAAGTTGCA
GCACAAGAATGGAGAACGCTAATAATTTCAAGCGCAAGGATGTGATGCAGATAGACGTTGCACCACTCATTAGTGCGCTAGCAGGGCTTCCATATCCTCG
AAACTCGGTAGGTGTTCTACCGTTTACGTACTTGACTAAGAACAAGTATCGTGTGAATGCCATGCGCGCCAATGCACAGCAGCTGTACCAGCATGCATTG
CGCAAGGAAGAAGTGAAGCACGCTAACCGAGGGTTACTGTTCATTCCCTACGCACCACTTCACAGCCGTGTGCCAGATCTGATGGCCCATATTGACGAAG
CCCTCAACAGCATTCCAGCAAGTGACGGTGAAAGCCATGCAATTCACAACGAGGCACACCATGTCATCGAAAATTGATCCAGGAGATGATCGATATCTGC
CGGAATGCGATCATATACTACCAGAGATATGACTGGTTGTTTTTGCTAGGATCAGTCATTCTAAGCTACGTCGGCTGGGCTCTAACCATGACTGTTGCCT
ATTTACAGCCCCAAAAATTCCGAGTGTCGTGGCTGTTGGTCCACATGATTGATGTAAAGTTTGTTGCTGCTGTGTAGTAGTGATGTGGTGGCGCTTTTTC
GCCAACTCGCCATCGACATACTATCTGTATGGACTGTGTCCTCTTATCTTATGGAATTTCGTTTGGAACTATCGCGATAAACTCCAAGCTGCACTCCCTC
TTGCTCAAGATTTTGGGTGGCAGCAGAGTGTTGAGATTGCAGCAATATTTTTGTGTCTGGAGCAAGTTGTCCTTGGTTATCAACACCGAGCCATATTCAG
CTTATTGTTCCTTCTGCTTGCGTTGAGGCCGAGAATTGCAGTTGGGCACGTTCGAGAACCAACCCGTGGACTGTACCAAAGAGACGGTGGGAGAAAGTTG
ACGTCGCCAACTTTCTGGTGGTCTGCTAGTT